Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

A Technique for Gene Editing in Natural Killer Cells Using CRISPR Cas9

1.2K weergaven

⸱

8 juli 2025

In dit artikel

Samenvatting

Source: Naeimi Kararoudi, M., et al. Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins. J. Vis. Exp. (2018).

This video demonstrates a technique for Cas9 ribonucleoprotein-mediated genetic modification of primary natural killer (NK) cells. A Cas9 ribonucleoprotein, consisting of a Cas9 endonuclease bound to a guide RNA (gRNA) formed by base pairing a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), is introduced into primary natural killer cells via electroporation. The ribonucleoprotein targets and cleaves the host DNA at the target site, leading to gene knockout via modification of the target gene through cellular repair machinery.

Protocol

All procedures involving sample collection have been performed in accordance with the institute's IRB guidelines.

1. Human NK Cell Purification and Expansion

  1. Isolate peripheral blood mononuclear cells (PBMCs) from Buffy Coat.
    1. Layer 35 mL of buffy coat sample on 15 mL of Ficoll-Paque.
    2. Centrifuge at 400 x g for 20 minutes without brake and collect the PBMC from the interface.
    3. Wash the recovered PBMCs three times by adding at least an equal volume of PBS, centrifuging at 400 x g for 5 minutes, and aspirating the PBC wash. NK cell can be isolated at this stage by RosettesSep.
  2. Expand NK cells by stimulating with irradiated 10 x 106 mbIL21-expressing feeder cells at Days 0, 7, and 14. Replace media with fresh RPMI containing 10% FBS, 1% Glutamine, 1% Penicillin Streptomycin, and 100 IU/mL of IL-2 for the entire media volume every other day.

2. gRNA Design and Selection

  1. Choose the specific genomic loci to target, using online tools, e.g., NCBI, Ensemble.
    Example.
    Description: Transforming growth factor beta receptor 2 (TGFBRR2) ectodomain
    View record: PF08917
    View InterPro: IPR015013
    Position: 49 - 157 aa
    Targeted Sequence: Exon 4 of TGFBR2 gene (ENSG00000163513)
  2. To design the gRNAs, use CRISPR design web tools such as http://crispr.mit.edu and 'Benchling.'
    1. Enter in the DNA sequence chosen in step 2.1. Choose human (hg 19) as a target genome. CRISPR guides (20 nucleotides followed by a protospacer adjacent motif (PAM) sequence: NGG) will be scanned from the sequence entered earlier. It also shows possible off-target matches throughout the selected genome.
    2. Choose the best three gRNAs which have the highest score, based on their on-target and off-target rates. For example, Table 1 shows the designed CRISPR RNAs to target exon 4 of TGFBR2 gene suggested by CRISPR design web tools.
  3. Order the CRISPR RNAs as synthetic sequence-specific crRNAs.
  4. Order a conserved, transactivating RNA (tracrRNA) to interact through partial homology with the crRNA.

3. Design Deletion Screening Primers

  1. Design primers spanning the gRNA cleavage sites for T7E1 mutation assay.
  2. Use primers at least 100 bp away from the predicted cleavage site to ensure small insertion-deletion (indels) at the sgRNA target site will appear on 1.5% agarose gel following the mutation assay. Table 2 shows the primers which are used to amplify the TGFBR2 ectodomain.

4. Transduction of Human Primary and Expanded NK Cells

Note: Transduction of Cas9/RNPs elements into NK is done by electroporation using 4D system as follows.

  1. Cell Preparation
    1. For primary NK cells, incubate freshly isolated NK cells in Roswell Park Memorial Institute (RPMI) medium in the presence of 100 IU/mL of IL-2 for 4 days and perform the electroporation at Day 5. Replace the media every other day as described earlier and the day before transduction.
    2. For expanded NK cells, stimulate the cells at day 0 with irradiated feeder cells at a ratio of 1:1 and perform the electroporation at Day 5 or 6 or 7. Replace the media every other day as described earlier and the day before transduction.
    3. On the day of electroporation, prepare a T25 flask filled with 8 mL of fresh RPMI containing 100 IU/mL of IL-2 for cells undergoing electroporation and pre-incubate flasks in a humidified 37 °C and 5% CO2 incubator.
      Note: Thawed cells or cells that have undergone 2nd or 3rd stimulation can be electroporated at any time after their recovery as described.
    4. Take 3 - 4 × 106 cells per condition for 26 µL of transduction mix.
      Note: Very high concentration of NK cells in electroporation solution enhances the transduction rate.
    5. Wash the cells 3 times with PBS to remove all FBS, which commonly contains RNase activity. Spin them down each time at 300 x g for 8 minutes.
      Note: Consider 7 electroporation conditions for Cas/RNPs as single gRNA (gRNA1, gRNA2, gRNA3) and a combination of two gRNAs (gRNA1+gRNA2, gRNA1+gRNA3, gRNA2+gRNA3) and one control with no Cas9/RNPs.
  2. Form the crRNA:tracerRNA/complex
    1. Resuspend crRNAs (gRNA1, gRNA2, and gRNA3) and tracerRNA in 1x TE solution to final concentrations of 200 μM. Mix 2.2 μL of each 200 μM gRNA with 200 μM tracerRNA as shown in Table 3.
    2. Heat the samples at 95 °C for 5 min and allow to cool on the bench top to room temperature (15 - 25 °C). Store resuspended RNAs and crRNA: tracrRNA/complex at -20 °C for later use.
  3. Form the RNP complex
    Note:
    To save time, form the RNP complex during the washing step 4.1.5.
    1. For single crRNA:tracrRNA duplex reaction, dilute Cas9 endonuclease to 36 μM as shown by the example in Table 4.
    2. For combination transduction of crRNA:tracrRNA duplexes, dilute Cas9 endonuclease to 36 μM as shown by the example in Table 5.
    3. Add Cas9 endonuclease to crRNA:tracrRNA duplexes slowly while swirling pipette tip, over 30 s to 1 minute.
    4. Incubate the mixture at room temperature for 15 - 20 min. If not ready to use the mixture after incubation, keep the mixture on ice until use.
  4. Electroporation
    1. Add the entire supplement to the electroporation solution P3 and keep it at room temperature.
    2. Resuspend the cell pellet (3 - 4 × 106 cells from step 4.1.5) in 20 μL of P3 primary 4D electroporation solution. Avoid air bubbles while pipetting.
      Note: The cells should not be left for a long time in P3 solution.
    3. Immediately add 5 µL of RNP complex (Step 4.3) to the cell suspension.
    4. Add 1 μL of 100 μM Cas9 electroporation enhancer to the Cas9/RNPs/cell mix.
    5. Transfer Cas9/RNPs/cell mix into 20 μL electroporation strips.
    6. Gently tap the strips to make sure that the sample covers the bottom of the strips.
    7. Start 4D electroporation system and choose the EN-138 program.

Table 1. Three designed gRNAs to target exon 4 of TGFBR2 ectodomain as synthetic crRNA.

gRNA NO.gRNA sequenceOrdered as synthetic crRNA
gRNA15 CCCCTACCATGACTTTATTC 3/AltR1/rArGrUrCrArUrGrGrUrArGrGrGrGrArGrCrUrUrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/
gRNA25 ATTGCACTCATCAGAGCTAC 3/AltR1/rArUrUrGrCrArCrUrCrArUrCrArGrArGrCrUrArCrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/
gRNA35 AGTCATGGTAGGGGAGCTTG 3/AltR1/rArG rUrCrA rUrGrG rUrArGrGrGrG rArGrC rUrUrG rGrUrUrUrUrA rGrArG rCrUrA rUrGrCrU/AltR2/

Table 2. Primers used to amplify the TGFBR2 ectodomain gene

TGFBR 2 ectodomain Primers FWD5 GTC TGC TCC AGG TGA TGT TTA T3
TGFBR2 ectodomain Primer REV5 GGG CCT GAG AAT CTG CAT TTA 3

Table 3. Form the crRNA:tracrRNA/complex using 200 µM RNAs

ComponentAmount (uL)
200 µM crRNA2.2
200 µM Tracer RNA2.2
IDTE Buffer5.6
Final product10

Table 4. For single crRNA:tracrRNA duplex reaction, dilute Cas9 endonuclease to 36 µM.

ComponentAmount (µL)
PBS1
crRNA:tracrRNA duplex (from step 4.2)2 (200 pmol)
Alt-R Cas9 endonuclease (61 µM stock)2
Total volume5 ul

Table 5. For combination transduction of crRNA:tracrRNA duplexes dilute Cas9 endonuclease to 36 µM.

ComponentAmount (µL)
PBS1
crRNA:tracrRNA duplex (ex. gRNA1)1 (100 pmol)
crRNA:tracrRNA duplex (ex. gRNA2)1 (100 pmol)
Alt-R Cas9 endonuclease2
Total volume5 µL

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Openbaarmakingen

No conflicts of interest declared.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
RosetteSep™ Human NK Cell Enrichment CocktailSTEMCELL Technologies15065The RosetteSep™ Human NK Cell Enrichment Cocktail is designed to isolate NK cells from whole blood by negative selection.
Ficoll-Paque® PLUSGE Healthcare - Life Sciences17-1440-02
Alt-R® CRISPR-Cas9 tracrRNAIntegrated DNA Technologies1072532TracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance. Hybridizes to crRNA to activate the Cas9 enzyme
Alt-R® CRISPR-Cas9 crRNAIntegrated DNA TechnologiesSynthetically produced as Alt-R® CRISPR-Cas9 crRNA, based on the sequence of designed gRNA targeting the gene of intrest
Alt-R® Genome Editing Detection KitIntegrated DNA Technologies1075931Each kit contains T7EI endonuclease, T7EI reaction buffer, and T7EI assay controls.
Platinum® Taq DNA Polymerase High FidelityInvitrogen11304-011
4D-Nucleofector™ SystemLonzaAAF-1002B
Human recombinant IL-2 ProteinNovartis65483-0116-07
P3 Primary Cell 4D-Nucleofector™ X KitLonzaV4XP-3032Contains pmaxGFP™ Vector, Nucleofector™ Solution, Supplement, 16-well Nucleocuvette™ Strips
Non-targeting: Custom siRNA, Standard 0.05 2mol ON-TARGETplusDharmaconCTM-360019
Alt-R® S.p. Cas9 Nuclease 3NLSIntegrated DNA Technologies1074181Cas9 Nuclease
DNeasy® Blood & Tissue HandbookQiagen69504
RNeasy Mini KitQiagen74104
Calcein AMThermoFisherC3099
TGFβBiolegend580706
Alt-R® CRISPR-Cas9 Control Kit, HumanIntegrated DNA Technologies1072554Includes tracrRNA, HPRT positive control crRNA, negative control crRNA#1, HPRT Primer Mix, and Nuclease-Free Duplex Buffer.
IDTE pH 7.5 (1X TE Solution)Integrated DNA Technologies11-01-02-02
Alt-R® Cas9 Electroporation EnhancerIntegrated DNA Technologies1075915Cas9 Electroporation Enhancer

Tags

RibonucleoproteïnecomplexElektroporatietechniekVorming van gids-RNADNA-splitsingCellulair reparatiemechanismeNucleofector-systeemIL-2-suppletie