Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

A Non-invasive Approach to Study the Electrophysiology of Motor Neurons in Zebrafish Embryos

814 weergaven

8 juli 2025

In dit artikel

Samenvatting

Source: Benedetti, L., et al. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (2017).

This video demonstrates a non-invasive assay to study electrophysiology of motor neurons in zebrafish embryos. Upon measuring tail coiling in the embryos as a result of spontaneous depolarization of the spinal cord motor neurons, a sodium channel blocker is applied to reduce the coiling frequency. Next, the embryos are immobilized in agarose and placed under a fluorescence microscope. The genetically engineered motor neurons express a voltage-sensing biosensor with a donor and an acceptor fluorophore. A decrease in acceptor fluorophore emission indicates a reduction in the spontaneous depolarization of motor neurons due to the sodium channel blocker.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

1. pHuC_Mermaid Plasmid Generation

NOTE: Mermaid is a biosensor developed by pairing the voltage-sensing domain (VSD) of the Ciona intestinalis (now Ciona robusta) voltage sensor containing phosphatase (Ci-VSP) with the fluorescence resonance energy transfer (FRET) partner fluorophores Umi-Kinoko Green (mUKG: donor) and a monomeric version of the orange-emitting fluorescent protein Kusabira Orange (mKOk: acceptor). For this biosensor, conformational changes of the VSD domain, induced by membrane depolarization, increase the proximity of the donor and acceptor fluorescent proteins, thus increasing the energy transfer between them (increasing the FRET Ratio). The VSD assures the efficient localization of the biosensor at the plasma membrane. The neuronal expression of the biosensor (in the spinal cord, the signal is detectable in both interneurons and motor neurons) is achieved by cloning the Mermaid open reading frame (ORF) under the zebrafish pan-neural promoter HuC.

  1. Amplify by polymerase chain reaction (PCR) the Mermaid open reading frame (ORF) from the pCS4+ Mermaid plasmid with Pfu (proofreading) DNA polymerase using the T3 Universal primer and the Mermaid SmaI primer (5′TATCCCGGGATTCGACGGTTCAGATTTTA) in order to insert a SmaI restriction site upstream of the Mermaid ORF.
    1. Use the following PCR mixture: 0.5 µL of Pfu DNA polymerase, 7.5 µL of the specific 10x buffer, 1 µL of 10 mM deoxynucleotide triphosphates (dNTPs), 2.5 µL of dimethyl sulfoxide (DMSO), 0.5 µL (50 ng) of the plasmid preparation, and 1 µL of 20-µM stock solutions of each primer in a total volume of 50 µL.
    2. Heat the PCR mixture for 15 s at 95 °C, prime it for 15 s at 50 °C, and elongate it for 4 min at 72 °C for a total of 35 cycles.
  2. Gel-purify the specific blunt PCR product using a commercial gel purification kit, following the manufacturer's protocol.
  3. Clone the DNA fragment into the pCMV-SC blunt vector following the manufacturer's protocol.
  4. Linearize the Mermaid-positive plasmid (named pCMV-SC_Mermaid) with the SmaI restriction enzyme for the following insertion of the HuC promoter.
    1. Set up the restriction reaction as follow: 0.5 µL (10 U) of SmaI restriction enzyme, 2 µL of the kit 10x buffer, and 5 µg of plasmid DNA in a total volume of 20 µL. Incubate the reaction at 25 °C for 1 h.
  5. Gel-purify the digested plasmid using a commercial gel purification kit following the manufacturer's protocol.
  6. PCR-amplify the HuC promoter (pHuC), with Pfu DNA polymerase and zebrafish genomic DNA as template, using a pair of HuC-specific primers (HuCprom-forw1_SalI: 5′-GTAGTCGACCAGACTTGTCAAAAGGGTCCA and HuCprom-rev1: 5′-TCCATTCTTGACGTACAAAGATG) and spanning a 3,150-bp region upstream of the ATG.
    1. Set up the PCR mixture using the following scheme: 0.5 µL of Pfu DNA polymerase, 7.5 µL of the specific 10x buffer, 1 µL of 10 mM dNTPs, 2.5 µL of DMSO, 200 ng of genomic DNA, and 1 µL of 20-µM stock solutions of each primer in a total volume of 50 µL.
    2. After an initial step of 2 min at 95 °C, heat the PCR mixture for 15 s at 95 °C, prime it for 15 s at 50°C, and elongate it for 4 min at 72 °C for a total of 35 cycles.
  7. Gel-purify the specific blunt PCR product using a commercial gel purification kit following the manufacturer's protocol.
  8. Ligate an equimolar amount of the purified pCMV-SC_Mermaid (step 1.5) and the pHuC DNA (step 1.7) using 1 µL of T4 DNA ligase and 1 µL of the specific 10X buffer in a total volume of 10 µL. Incubate the reaction for 16 h at 4 °C.
  9. Transform an aliquot of competent cells with 5 µL of the ligation reaction (step 1.8) following the manufacturer's instructions.
  10. Select the pHuC-positive clones (pHuC_Mermaid) with the promoter inserted in the proper orientation by a SalI-EcoRV double digestion (the SalI restriction site has been inserted upstream of the promoter fragment in step 1.6, while the EcoRV restriction site is positioned downstream of the polyadenylation region, PolyA, of the pCMV-SC plasmid).
    1. Set up the restriction reaction as follow: 0.5 µL (10 U) of both SalI and EcoRV restriction enzymes, 2 µL of the kit10X buffer, and 1 µg of pHuC_Mermaid DNA in a total volume of 20 µL. Incubate the reaction at 37 °C for 1 h. Run the reactions onto an agarose gel.

2. Embryo Microinjection

  1. Transfer the fertilized eggs obtained from wild-type (AB strain) or Sod1-G93R adult zebrafish to a 10 mm Petri dish using a plastic pipette.
  2. Rinse the embryos in cold (4 °C) fish water and immediately microinject them into the yolk with 200 pg of pHuC_Mermaid plasmid using a microinjector (for an overall and detailed description of the microinjection procedure).
  3. Using a plastic pipette, transfer the embryos to a Petri dish and incubate them in fish water at 28 °C until they reach the desired developmental stage (20-24 h post-fertilization, hpf) for the following analyses.

3. Spontaneous Tail Coiling Analysis

NOTE: Evaluate the spontaneous tail coiling behavior in 20-24 hpf embryos with or without the drug riluzole.

  1. Transfer an embryo to a 90-mm round Petri dish filled with fish water containing 0.2% DMSO (riluzole vehicle) and manually dechorionate it using two jeweler's forceps with sharp tips. Incubate the embryo for 5 min.
  2. Detect the tail coiling at room temperature (RT) during a 1 min video recording using a digital camera mounted on a stereomicroscope. Acquire time series at a time resolution of 30 frames/s.
  3. Calculate the frequency of spontaneous tail coilings by counting the number of bends (both contralateral and ipsilateral) per time unit.
  4. To evaluate the effect of the drug riluzole, gently use a plastic Pasteur pipette to transfer the embryo to a new 90 mm Petri dish filled with fish water containing 5 µM riluzole.
    1. Incubate the embryo for 5 min before recording a 1-min video and performing the behavioral analysis as above.

4. Imaging Setup for Mermaid Biosensor Visualization in Living Embryos: Simultaneous Detection of Donor and Acceptor Signals

  1. Mount the 20 - 24 hpf embryos in 1% low-melting-point agarose in fish water at 37 °C inside a 35 mm glass-bottomed imaging dish. Orient the embryos on their sides. Wait until the agarose solidifies at room temperature.
  2. Transfer the imaging dish to the stage of an inverted confocal mounted on an inverted microscope. Identify motor neurons expressing the biosensor with a 20X objective (0.7 numerical aperture, NA) by exciting the mUKG with the 488 nm argon laser line and recording its emission between 495 and 525 nm.
  3. For a FRET measurement, excite mUKG, the donor of the FRET pair, with the 488 nm laser line. Simultaneously detect, with a resonant scanner operating at 8,000 Hz in the bidirectional mode, the fluorescence emitted by the donor (between 495 and 525 nm) and the fluorescence emitted by the mKOk acceptor (between 550 and 650 nm, FRET channel). If available, use the 473 nm laser.
    NOTE: The excitation efficiency of the donor will be slightly reduced (85% instead of 93% with 488 nm), but the cross-excitation of the acceptor will be reduced as well (from 17% with the 488 nm to 9% with 473 nm laser line).
  4. To reduce phototoxicity and fluorophore bleaching, minimize the illumination of the sample by reducing the power of the laser line (on the beam path window of the acquisition software).
  5. Optimize the excitation to match gain and offset parameters that are set at the beginning of the experiment and kept constant throughout the session. To set the offset, change the color of the image to intensity values (by using the Q look-up table) and, while scanning with the laser off, turn the offset knob (smart offset) so that the background pixels have an intensity slightly higher than zero. With the same look-up table, by switching the laser on while scanning, turn the gain knob (smart gain) to maximize the signal-to-noise ratio, being careful to avoid saturated pixels.
  6. Using an opened pinhole (2 airy units), acquire 16-bit images to provide a sufficient dynamic range for quantitative analyses. Avoid averaging to increase the acquisition speed and to minimize photobleaching.
  7. In the software acquisition window, select an image field size of 512 x 64 pixels (pixel size: 605 nm) from the drop-down menu.
  8. From the acquisition mode window, select xyt (time lapse on a single xy plane) from the drop-down menu and record the changes in embryo spinal neuron voltage by acquiring a single xy plane, setting the acquisition parameters to record one image every 30 ms for 1 min.
  9. To evaluate the effect of riluzole administration on membrane depolarization in the same neuron, acquire a new dataset 5 min after the addition of fish water containing 5 µM riluzole.
  10. For FRET analysis, use the ImageJ macro Biosensor_FRET (expressing single-chain FRET biosensors.)
  11. Evaluate the basal membrane FRET ratio of each neuron at t1 as ((FRET mean - FRET background)/(Donor mean - Donor background)), where FRET and Donor mean intensity is the mean fluorescence intensity calculated in the same region of interest (ROI) drawn around the cell for each channel acquired and FRET and Donor background is the mean fluorescence intensity calculated in an ROI of the field of view without the fluorescent sample.
    NOTE: A detailed step-by-step description of the use of the plugin can be found at the www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret website.
  12. Use a graphing software to compare the frequency, amplitude, and duration of depolarization between different experimental paradigms. Compare two groups using an unpaired Student's t-test and consider mean values as statistically different when P <0.05.

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Openbaarmakingen

No conflicts of interest declared.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
Low Melting Point AgaroseSigma-AldrichA9414
DMSOSigma-AldrichW387520
RiluzoleSigma-AldrichR116
Pfu Ultra HQ DNA polymeraseAgilent Technologies - Stratagene Products Division600389
T3 Universal primerSigma-Aldrich
Wizard SV Gel and PCR Clean-Up systemPromegaA9280
Universal SmaI primerEurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vectorAgilent Technologies - Stratagene Products Division240228
SmaINew England BiolabsR0141S
T4 DNA ligasePromegaM1801
SalINew England BiolabsR0138S
EcoRVNew England BiolabsR0195S
35 mm, glass-bottomed imaging dishIbidi81151
forcepsSigma-AldrichF6521
StereomicroscopeLeica MicrosystemsM10 F
Digital cameraLeica MicrosystemsDFC 310 FX
Leica Application Suite 4.7.1 softwareLeica Microsystems
QuickTime Player, v10.4Apple
Confocal microscope (inverted)Leica MicrosystemsTCS SP5
MicroinjectorEppendorfFemtojet
ImageJ macro Biosensor_FRET
GraphPad Prism 6.0cGraphPad Software, Inc

Tags

Elektrofysiologie van motorneuronenanalyse van staartkrullingnatriumkanaalblokkerfluorescentiemicroscopieconfocale microscopieFRET-metingspanningsgevoelige biosensorbehandeling met riluzolspontane depolarisatie