| HEK 293A cell line | Thermo Fisher scientific | R70507 | |
| DMEM (1X) Dulbecco's Modified Eagle Medium | Gibco by life technologies | 21969-035 | (+) 4,5g/L D-Glucose 0,11g/L Sodium Pyruvate (-) L-Glutmine |
| RPMI medium1640 (1X) | Gibco by life technologies | 31870-025 | |
| Bovine Serum Albumine (BSA) | PAA | K45-001 | |
| Nutridoma-SP | Roche | 11011375001 | 100X Conc |
| PBS-Phosphate Buffered Saline (10X) pH 7,4 | Ambion | AM9624 | |
| EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8 | Invitrogen by Life Technologies | 15575-020 | |
| Fetal Bovine serum (FBS) | Dominique Dutscher | S1810-500 | |
| Ficoll - lymphocytes separation medium | EuroBio | CMSMSL01-01 | density 1,0777+/-0,001 |
| streptavidin R-phycoerythrin conjugate | Invitrogen by Life Technologies | S21388 | premiun grade 1mg/ml contains 5mM sodium azide |
| Streptavidin, allophycocyanin conjugate | Invitrogen by thermoFisher scientific | S32362 | 1mg/ml 2mM azide premium grade |
| Brilliant violet 421 streptavidin | Biolegend | 405225 | conc : 0,5mg/ml |
| Anti-PE conjugated magnetic MicroBeads | Miltenyi Biotec | 130-048-801 | |
| Anti-APC conjugated magnetic MicroBeads | Miltenyi Biotec | 130-090-855 | |
| MidiMACs or QuadroMACS separotor | Miltenyi Biotec | 130-042-302/130-090-976 | |
| LS Columns | Miltenyi Biotec | 130-042-401 | |
| CD3 BV510 BD horizon | BD Pharmingen / BD Biosciences | 563109 | Used dilution 1:20 |
| CD19 FITC | BD Pharmingen / BD Biosciences | 345788 | Used dilution 1:20 |
| CD14 PerCPCy5.5 | BD Pharmingen / BD Biosciences | 561116 | Used dilution 1:50 |
| CD16 PerCPCy5.5 | BD Pharmingen / BD Biosciences | 338440 | Used dilution 1:50 |
| 7AAD | BD Pharmingen / BD Biosciences | 51-68981E (559925) | Used dilution 1:1000 |
| FACS ARIA III Cell Sorter Cytometer | BD Biosciences | | |
| 8-strip PCR tubes | Axygen | 321-10-061 | |
| Racks for 96 microtubes | Dominique Dutscher | 45476 | |
| RNAseOUT Ribonuclease Inhibitor (recombinant) | Invitrogen by thermoFisher scientific | 10777-019 | qty:5000U (40U/ul) |
| Distilled Water Dnase/Rnase Free | Gibco | 10977-035 | |
| Oligod(T)18 mRNA Primer | New England BioLabs | S1316S | 5.0 A260unit |
| Random hexamers | Invitrogen by thermoFisher scientific | N8080127 | qty : 50uM, 5nmoles |
| Superscript III Reverse transcriptase | Invitrogen by thermoFisher scientific | 18080-044 | qty : 10000U (200U/ul) |
| GoTaq G2 Flexi DNA polymerase | Promega | M7805 | |
| dNTP Set, Molecular biology grade | Thermo Scientific | R0182 | 4*100umol |
| 5LVH1 | Eurofins | ACAGGTGCCCACT CCCAGGTGCAG | First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers |
| 5LVH3 | Eurofins | AAGGTGTCCAGTG TGARGTGCAG | First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers |
| 5LVL4_6 | Eurofins | CCCAGATGGGTCC TGTCCCAGGTGCAG | First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers |
| 5LVH5 | Eurofins | CAAGGAGTCTGTT CCGAGGTGCAG | First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers |
| 3HuIgG_const_anti | Eurofins | TCTTGTCCACCTT GGTGTTGCT | First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening |
| 3CuCH1 | Eurofins | GGGAATTCTCACA GGAGACGA | First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig |
| 5AgeIVH1_5_7 | Eurofins | CTGCAACCGGTGTACATTCC GAGGTGCAGCTGGTGCAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH3 | Eurofins | CTGCAACCGGTGTACATTCT GAGGTGCAGCTGGTGGAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH3_23 | Eurofins | CTGCAACCGGTGTACATTCT GAGGTGCAGCTGTTGGAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH4 | Eurofins | CTGCAACCGGTGTACATTCC CAGGTGCAGCTGCAGGAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH4_34 | Eurofins | CTGCAACCGGTGTACATTCC CAGGTGCAGCTACAGCAGTG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH1_18 | Eurofins | CTGCAACCGGTGTACATTCC CAGGTTCAGCTGGTGCAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH1_24 | Eurofins | CTGCAACCGGTGTACATTCC CAGGTCCAGCTGGTACAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH3__9_30_33 | Eurofins | CTGCAACCGGTGTACATTCT GAAGTGCAGCTGGTGGAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |
| 5AgeIVH6_1 | Eurofins | CTGCAACCGGTGTACATTCC CAGGTACAGCTGCAGCAG | Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers |