Method Article

Transcellulaire interacties meten via eiwitaggregatie in een heterologe celsysteem

DOI:

10.3791/61237

May 22nd, 2020

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Hier presenteren we een geoptimaliseerd protocol om snel en semiquantitatief ligand-receptor interacties in trans te meten in een heterologe celsysteem met behulp van fluorescentiemicroscopie.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Eiwitinteracties op cellulaire interfaces dicteren een veelheid aan biologische uitkomsten, variërend van weefselontwikkeling en kankerprogressie tot synapsvorming en -onderhoud. Veel van deze fundamentele interacties komen voor in trans en worden meestal veroorzaakt door heterofiele of homofiele interacties tussen cellen die membraanverankerde bindingsparen uitdrukken. Het ophelderen hoe ziekterelevante mutaties deze fundamentele eiwitinteracties verstoren, kan inzicht geven in een groot aantal celbiologievelden. Veel eiwit-eiwit interactietests zijn meestal niet disambiguate tussen cis en trans interacties, wat mogelijk leidt tot een overschatting van de mate van binding die optreedt in vivo en omvat arbeidsintensieve zuivering van eiwitten en / of gespecialiseerde bewakingsapparatuur. Hier presenteren we een geoptimaliseerd eenvoudig protocol dat het mogelijk maakt om alleen transinteracties te observeren en te kwantificeren zonder dat langdurige eiwitzuiveringen of gespecialiseerde apparatuur nodig zijn. De HEK-celaggregatietest omvat het mengen van twee onafhankelijke populaties HEK-cellen, die elk membraangebonden cognate liganden uitdrukken. Na een korte incubatieperiode worden monsters in beeld genomen en worden de resulterende aggregaten gekwantificeerd.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Synaptische interacties gefaciliteerd door synaptische adhesiemoleculen zijn fundamenteel voor de ontwikkeling, organisatie, specificatie, onderhoud en functie van synapsen en de generatie van neurale netwerken. De identificatie van deze transsynaptische celhechtingsmoleculen neemt snel toe; het is dus van fundamenteel belang om bindende partners te identificeren en te begrijpen hoe deze nieuwe hechtingsmoleculen met elkaar interageren. Bovendien heeft genoomsequentie mutaties geïdentificeerd in veel van deze hechtingsmoleculen die vaak verband houden met een veelheid aan neuroontwikkelings-, neuropsychiatrische en verslavingsstoornissen1. Muta....

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Celcultuur en transfectie

  1. Maak HEK celmedia met DMEM, 1x (Dulbecco's Modification of Eagle's Medium) aangevuld met 4,5 g/L glucose, L-glutamine & natriumpyruvaat en 10% FBS. Steriel filter.
  2. Bepaal vooraf geschikte liganden en receptoren voor aggregatietest.
    OPMERKING: Neurexin3α SS4+/- en een van de bekende liganden, LRRTM2, werden gebruikt in deze studie. Liganden en receptoren van belang werden uitgedrukt uit cDNA's in pcDNA3.1. Een Gibson-assemblage werd gebruikt om Neurexin3α in pcDNA3.112te plaatsen. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/
    GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATT....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

De A687T-mutatie verhoogt de Neurexin3α SS4-binding aan LRRTM27
Om te onderzoeken hoe intercellulaire interacties van twee bekende synaptische eiwitten worden beïnvloed door de introductie van een puntmutatie gevonden bij een patiënt met een verstandelijke beperking en epilepsie, gebruikten we de bovenstaande HEK-celaggregatietest (figuur 1). Cellen werden getransfecteerd volgens sectie 1 en voorbereid op beeldvorming volgens secties 1 en 2 van het protocol. Ce.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Het ontleden van de eiwit-eiwitinteracties die optreden in trans tijdens celhechting kan leiden tot een beter begrip van de moleculaire mechanismen die ten grondslag liggen aan basis cellulaire processen, waaronder de vorming, functie en onderhoud van synapsen tijdens rijping en remodellering. De implicaties van cel-celinteracties breiden zich verder uit dan neurobiologie en hebben een bredere rol in signaaltransductie, celmigratie en weefselontwikkeling14. Aberraties in celhechting kunnen cellula.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

De auteurs hebben niets te onthullen.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Dit werk werd ondersteund door grants van het National Institute of Mental Health (R00MH103531 en R01MH116901 aan J.A.), een predoctorale training Grant van het National Institute of General Medicine (T32GM007635 to S.R.), en een Lyda Hill Gilliam Fellowship for Advanced Study (GT11021 to S.R.). We danken Dr. Kevin Woolfrey voor hulp met de microscoop, Dr. K Ulrich Bayer voor het gebruik van zijn epifluorescente microscoop, en Thomas Südhof (Stanford University) voor de LRRTM2 plasmide.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL disposable microtubes with snap capsVWR89000-028Incubation of mixed population of HEK cells
1000 mL Rapid—Flow Filter Unit, 0.2 um aPES membraneThermo Fisher567-0020Sterilization of HEK media
15 mL SpectraTube centrifuge tubesWard’s Science470224-998Harvesting HEK cells
6 well sterile tissue culture platesVWR100062-892culturing HEK cells
Calcium ChlorideSigma223506-500GCalcium phosphate transfection, HEK cell resuspension
Centrifuge- Sorvall Legend RTKendro Laboratory Products75004377Harvesting HEK cells
CO2 cell incubatorThermo ScientificHERACELL 150iIncubation of HEK cells during growth
DMEM, 1x (Dulbecco's Modification of Eagle's Medium) with 4.5 g/L glucose, L-glutamine & sodium pyruvateCorning10-013-CVHEK cell maintenance
Dulbecco’s Phosphate Buffered Saline PBS (1X)Gibco14190-144Passaging/harvesting HEK cell
Ethylenediaminetetraacetic acidSigmaED-500GHarvesting HEK cells
Falcon Vented culture flasks, 75cm2 growth areaCorning9381M26Culturing HEK cells
Fetal Bovine SerumSigma17L184HEK cell maintenance
HEK293T cellsATCCModel system
ImageJNIHV: 2.0.0-rc-69/1.52pImage analysis
Magnesium Chloride hexahydrateSigmaM9272-500GHEK cell resuspension
Sodium phosphate dibasic anhydrousFisher BioReagentsBP332-500Calcium phosphate transfection
Trypsin 0.25% (1X) SolutionGE Healthcare Life SciencesSH30042.01Passaging HEK cells
Tube rotatorIncubation of mixed population of HEK cells
UltraClear Microscope slides. White Frosted, Positive ChargedDenville Scientific Inc.M1021Image acquisition
Wide-field microscopeZeissAxio Vert 200MImage acquisition

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Südhof, T. C. Neuroligins and neurexins link synaptic function to cognitive disease. Nature. 455 (7215), 903-911 (2008).
  2. Lakey, J. H., Raggett, E. M. Measuring protein-protein interactions. Current Opinion in Structural Biology. 8 (1), 119-123 (1998).
  3. ....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Transcellular InteractionsProtein AggregationHEK Cell AggregationTrans Adhesion AssayFluorescence ImagingCell CountingEDTA TreatmentCentrifugation ProtocolGFP mCherry LabelingAdhesion Molecule Screening

Related Articles