Name: DNAzyme 10-23 - Op basis van nanomachines voor nucleïnezuurherkenning (Video) | JoVE Journal
Uploaded: 2024-02-09T14:40:00.000+00:00
Duration: 7 min 16 s
Description: Leer DNAzyme-gebaseerde nanomachines ontwerpen voor nucleïnezuurherkenning met behulp van gratis software. Deze methode toont hoge selectiviteit bij de detectie van virale fragmenten zoals Epstein-Barr.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<meta charset="utf8"></head><body>Precisie DNAzyme nanomachines voor discriminerende RNA- en DNA-analyse

<ol><li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolution+of+hybridization+probes+to+DNA+machines+and+robots%5BTitle%5D)+AND+%22Acc.+Chem+Res%22%5BJournal%5D)">Evolution of hybridization probes to DNA machines and robots.</a> Acc. Chem Res. 52, 1949-1956 (2019).</li>
<li>Guo, J., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fluorescent+hybridization+probes+for+nucleic+acid+detection%5BTitle%5D)+AND+%22Anal.+Bioanal+Chem%22%5BJournal%5D)">Fluorescent hybridization probes for nucleic acid detection.</a> Anal. Bioanal Chem. 402, 3115-3125 (2012).</li>
<li>Demidov, V. V., Frank-Kamenetskii, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Two+sides+of+the+coin%3A+affinity+and+specificity+of+nucleic+acid+interactions%5BTitle%5D)+AND+%22Tr+Bioche+Sc%22%5BJournal%5D)">Two sides of the coin: affinity and specificity of nucleic acid interactions.</a> Tr Bioche Sc. 29 (2), 62-71 (2004).</li>
<li>Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Binary+probes+for+nucleic+acid+analysis%5BTitle%5D)+AND+%22Chem+Rev%22%5BJournal%5D)">Binary probes for nucleic acid analysis.</a> Chem Rev. 110, 4709-4723 (2010).</li>
<li>Marti, A. A., Jockusch, S., Stevens, N., Ju, J., Turro, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fluorescent+hybridization+probes+for+sensitive+and+selective+DNA+and+RNA+detection%5BTitle%5D)+AND+%22Acc+Chem+Res%22%5BJournal%5D)">Fluorescent hybridization probes for sensitive and selective DNA and RNA detection.</a> Acc Chem Res. 40 (6), 402-409 (2007).</li>
<li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+bacterial+16S+rRNA+using+a+molecular+beacon-based+X+sensor%5BTitle%5D)+AND+%22Biosens.Bioelectron%22%5BJournal%5D)">Detection of bacterial 16S rRNA using a molecular beacon-based X sensor.</a> Biosens.Bioelectron. 41, 386-390 (2013).</li>
<li>Dark, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Accuracy+of+LightCycler+Septi+Fast+for+the+detection+and+identification+of+pathogens+in+the+blood+of+patients+with+suspected+sepsis%3A+a+systematic+review+and+meta-analysis%5BTitle%5D)+AND+%22Intensive+Care+Med%22%5BJournal%5D)">Accuracy of LightCycler Septi Fast for the detection and identification of pathogens in the blood of patients with suspected sepsis: a systematic review and meta-analysis.</a> Intensive Care Med. 41, 21-33 (2015).</li>
<li>Maltzeva, Y. I., Gorbenko, D. A., Nikitina, E. V., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visual+Detection+of+Stem-Loop+Primer+Amplification+%28SPA%29+products+without+denaturation+using+peroxidase-like+DNA+machines+%28PxDM%29%5BTitle%5D)+AND+%22Int+J+Mol+Sc%22%5BJournal%5D)">Visual Detection of Stem-Loop Primer Amplification (SPA) products without denaturation using peroxidase-like DNA machines (PxDM).</a> Int J Mol Sc. 24 (9), 7812(2023).</li>
<li>Gorbenko, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+nanomachine+for+visual+detection+of+structured+RNA+and+double+stranded+DNA%5BTitle%5D)+AND+%22Chem+Comm%22%5BJournal%5D)">DNA nanomachine for visual detection of structured RNA and double stranded DNA.</a> Chem Comm. 58 (35), 5395-5398 (2022).</li>
<li>Roembke, B. T., Nakayama, S., Sintim, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleic+acid+detection+using+G-quadruplex+amplification+methodologies%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Nucleic acid detection using G-quadruplex amplification methodologies.</a> Methods. 64 (3), 185-198 (2013).</li>
<li>Mokany, E., Bone, S. M., Young, P. E., Doan, T. B., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MNAzymes%2C+a+versatile+new+class+of+nucleic+acid+enzymes+that+can+function+as+biosensors+and+molecular+switches%5BTitle%5D)+AND+%22JACS%22%5BJournal%5D)">MNAzymes, a versatile new class of nucleic acid enzymes that can function as biosensors and molecular switches.</a> JACS. 132 (3), 1051-1059 (2010).</li>
<li>Gerasimova, Y. V., Cornett, E., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+cleaving+deoxyribozyme+sensor+for+nucleic+acid+analysis%3A+the+limit+of+detection%5BTitle%5D)+AND+%22Chem+Bio+Chem%22%5BJournal%5D)">RNA cleaving deoxyribozyme sensor for nucleic acid analysis: the limit of detection.</a> Chem Bio Chem. 11, 811-817 (2010).</li>
<li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria%5BTitle%5D)+AND+%22Angew+Chem+Int+Ed%22%5BJournal%5D)">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li>
<li>Hu, M., et al. Allosteric DNAzyme-based encoder for molecular information transfer. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aHu%2C+M+%22Chin.+Chem+Let%22">Chin. Chem Let</a>. , 109232(2023).</li>
<li>Peeters, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Solid-phase+PCR-amplified+DNAzyme+activity+for+real-time+FO-SPR+detection+of+the+MCR-2+gene%5BTitle%5D)+AND+%22Anal+Chem%22%5BJournal%5D)">Solid-phase PCR-amplified DNAzyme activity for real-time FO-SPR detection of the MCR-2 gene.</a> Anal Chem. 92 (15), 10783-10791 (2020).</li>
<li>Wood, H. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Species+typing+of+nontuberculous+Mycobacteria+by+use+of+deoxyribozyme+sensors%5BTitle%5D)+AND+%22Clin+Chem%22%5BJournal%5D)">Species typing of nontuberculous Mycobacteria by use of deoxyribozyme sensors.</a> Clin Chem. 65 (2), 333-341 (2019).</li>
<li>Yan, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ultralow+background+one-pot+detection+of+Lead+%28II%29+using+a+non-enzymatic+double-cycle+system+mediated+by+a+hairpin-involved+DNAzyme%5BTitle%5D)+AND+%22Biosen+Bioelectron%22%5BJournal%5D)">Ultralow background one-pot detection of Lead (II) using a non-enzymatic double-cycle system mediated by a hairpin-involved DNAzyme.</a> Biosen Bioelectron. 237, 115534(2023).</li>
<li>Hasick, N. J., Radhika, R., Todd, A. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Subzymes%3A+Regulating+DNAzymes+for+point+of+care+nucleic+acid+sensing%5BTitle%5D)+AND+%22Sens.+Act.+B%3A+Chem%22%5BJournal%5D)">Subzymes: Regulating DNAzymes for point of care nucleic acid sensing.</a> Sens. Act. B: Chem. 297, 126704(2019).</li>
<li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA-only%2C+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes%5BTitle%5D)+AND+%22Biosen+Bioelectron%22%5BJournal%5D)">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017(2020).</li>
<li>Cox, A. J., Bengtson, H. N., Gerasimova, Y. V., Rohde, K. H., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+antenna+tile-associated+deoxyribozyme+sensor+with+improved+sensitivity%5BTitle%5D)+AND+%22Chem+Bio+Chem%22%5BJournal%5D)">DNA antenna tile-associated deoxyribozyme sensor with improved sensitivity.</a> Chem Bio Chem. 17 (21), 2038-2041 (2016).</li>
<li>Lyalina, T. A., Goncharova, E. A., Prokofeva, N. Y., Voroshilina, E. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+DNA+minimachine+for+selective+and+sensitive+detection+of+DNA%5BTitle%5D)+AND+%22Analyst%22%5BJournal%5D)">A DNA minimachine for selective and sensitive detection of DNA.</a> Analyst. 144 (2), 416-420 (2019).</li>
<li>Ateiah, M., Gandalipov, E. R., Rubel, A. A., Rubel, M. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+Nanomachine+%28DNM%29+Biplex+Assay+for+Differentiating+Bacillus+cereus+Species%5BTitle%5D)+AND+%22Int+J+Mol+Sc%22%5BJournal%5D)">DNA Nanomachine (DNM) Biplex Assay for Differentiating Bacillus cereus Species.</a> Int J Mol Sc. 24 (5), 4473(2023).</li>
<li>El-Deeb, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Toward+a+home+test+for+COVID-19+diagnosis%3A+DNA+machine+for+amplification-free+SARS-CoV-2+detection+in+clinical+samples%5BTitle%5D)+AND+%22Chem+Med+Chem%22%5BJournal%5D)">Toward a home test for COVID-19 diagnosis: DNA machine for amplification-free SARS-CoV-2 detection in clinical samples.</a> Chem Med Chem. 17 (20), 202200382(2022).</li>
<li>Kirichenko, A., Bryushkova, E., Dedkov, V., Dolgova, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Novel+DNAzyme-based+fluorescent+biosensor+for+detection+of+RNA-containing+Nipah+henipavirus%5BTitle%5D)+AND+%22Biosensors%22%5BJournal%5D)">A Novel DNAzyme-based fluorescent biosensor for detection of RNA-containing Nipah henipavirus.</a> Biosensors. 13 (2), 252(2023).</li>
<li>Akhmetova, M. M., Rubel, M. S., Afanasenko, O. S., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Barley+haplotyping+using+biplex+deoxyribozyme+nanomachine%5BTitle%5D)+AND+%22Sens+Act+Rep%22%5BJournal%5D)">Barley haplotyping using biplex deoxyribozyme nanomachine.</a> Sens Act Rep. 4, 100132(2022).</li>
<li>Okonechnikov, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unipro+UGENE%3A+a+unified+bioinformatics+toolkit%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Unipro UGENE: a unified bioinformatics toolkit.</a> Bioinformatics. 28, 1166-1167 (2012).</li>
<li>Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mfold+web+server+for+nucleic+acid+folding+and+hybridization+prediction%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Mfold web server for nucleic acid folding and hybridization prediction.</a> Nucleic Acids Res. 31 (13), 3406-3415 (2003).</li>
<li>Markham, N. R., Zuker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DINAMelt+web+server+for+nucleic+acid+melting+prediction%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">DINAMelt web server for nucleic acid melting prediction.</a> Nucleic Acids Res. 33, Web Server issue W577-W581 (2005).</li>
<li>Stancescu, M., Fedotova, T. A., Hooyberghs, J., Balaeff, A., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonequilibrium+hybridization+enables+discrimination+of+a+point+mutation+within+5-40+C%5BTitle%5D)+AND+%22JACS%22%5BJournal%5D)">Nonequilibrium hybridization enables discrimination of a point mutation within 5-40 C.</a> JACS. 138 (41), 13465-13468 (2016).</li>
<li>Dong, J., Ouyang, Y., Wang, J., O'Hagan, M. P., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assembly+of+dynamic+gated+and+cascaded+transient+DNAzyme+networks%5BTitle%5D)+AND+%22ACS+Nano%22%5BJournal%5D)">Assembly of dynamic gated and cascaded transient DNAzyme networks.</a> ACS Nano. 16 (4), 6153-6164 (2022).</li>
<li>Montserrat Pagès, A., Hertog, M., Nicolaï, B., Spasic, D., Lammertyn, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unraveling+the+kinetics+of+the+10-23+RNA-cleaving+DNAzyme%5BTitle%5D)+AND+%22Int+J+Mol+Sc%22%5BJournal%5D)">Unraveling the kinetics of the 10-23 RNA-cleaving DNAzyme.</a> Int J Mol Sc. 24 (18), 13686(2023).</li>
<li>Nguyen, C., Grimes, J., Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular-beacon-based+tricomponent+probe+for+SNP+analysis+in+folded+nucleic+acids%5BTitle%5D)+AND+%22Chem-eur+J%22%5BJournal%5D)">Molecular-beacon-based tricomponent probe for SNP analysis in folded nucleic acids.</a> Chem-eur J. 17 (46), 13052-13058 (2011).</li>
<li>MacDougall, D., Crummett, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Guidelines+for+data+acquisition+and+data+quality+evaluation+in+environmental+chemistry%5BTitle%5D)+AND+%22Anal+Chem%22%5BJournal%5D)">Guidelines for data acquisition and data quality evaluation in environmental chemistry.</a> Anal Chem. 52 (14), 2242-2249 (1980).</li>
<li>Gerasimova, Y. V., Yakovchuk, P., Dedkova, L. M., Hecht, S. M., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expedited+quantification+of+genetically+modified+ribosomal+RNA+by+binary+deoxyribozyme+sensors%5BTitle%5D)+AND+%22RNA%22%5BJournal%5D)">Expedited quantification of genetically modified ribosomal RNA by binary deoxyribozyme sensors.</a> RNA. 10, 1834-1843 (2015).</li>
<li>Gerasimova, Y. V., Kolpashchikov, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Folding+16S+RNA+in+a+signal-producing+structure+for+detection+of+bacteria%5BTitle%5D)+AND+%22Angew+Chem+Int+Ed%22%5BJournal%5D)">Folding 16S RNA in a signal-producing structure for detection of bacteria.</a> Angew Chem Int Ed. 52, 10586-10588 (2013).</li>
<li>GC Content Calculator. , Available from: 
 <a target="_blank" href="https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU">https://www.biologicscorp.com/tools/GCContent/#.ZEfxPiyOHYU</a> (2023).</li>
<li>Hussein, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNAzyme+nanomachine+with+fluorogenic+substrate+delivery+function%3A+advancing+sensitivity+in+nucleic+acid+detection%5BTitle%5D)+AND+%22Anal+Chem%22%5BJournal%5D)">DNAzyme nanomachine with fluorogenic substrate delivery function: advancing sensitivity in nucleic acid detection.</a> Anal Chem. 95 (51), 18667-18672 (2023).</li>
<li>Safdar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA-only%2C+microwell-based+bioassay+for+multiplex+nucleic+acid+detection+with+single+base-pair+resolution+using+MNAzymes%5BTitle%5D)+AND+%22Biosen+Bioelectron%22%5BJournal%5D)">DNA-only, microwell-based bioassay for multiplex nucleic acid detection with single base-pair resolution using MNAzymes.</a> Biosen Bioelectron. 152, 112017(2020).</li>
<li>Gerasimova, Y. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Deoxyribozyme+cascade+for+visual+detection+of+bacterial+RNA%5BTitle%5D)+AND+%22Chem+Bio+Chem%22%5BJournal%5D)">Deoxyribozyme cascade for visual detection of bacterial RNA.</a> Chem Bio Chem. 14, 2087-2090 (2013).</li>
<li>Eckert, K. A., Kunkel, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+polymerase+fidelity+and+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Gen+Res%22%5BJournal%5D)">DNA polymerase fidelity and the polymerase chain reaction.</a> Gen Res. 1 (1), 17-24 (1991).</li>
<li>Pandya, K., Jagani, D., Singh, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas+systems%3A+Programmable+nuclease+revolutionizing+the+molecular+diagnosis%5BTitle%5D)+AND+%22Mol+Biotech%22%5BJournal%5D)">CRISPR-Cas systems: Programmable nuclease revolutionizing the molecular diagnosis.</a> Mol Biotech. , (2023).</li>
</ol>

<table><tbody><tr><td>1.5 mL tube</td><td>Biofil</td><td>CFT011015</td><td></td></tr><tr><td>100 bp+ DNA Ladder</td><td>Evrogen</td><td>NL002</td><td></td></tr><tr><td>100-1000 &micro;L pipette</td><td>Kirgen</td><td>KG-Pro1000</td><td></td></tr><tr><td>10-100 &micro;L pipette</td><td>Kirgen</td><td>KG-Pro100</td><td></td></tr><tr><td>1-10 &micro;L pipette</td><td>Kirgen</td><td>KG-Pro10</td><td></td></tr><tr><td>20-200 &micro;L pipette</td><td>Kirgen</td><td>KG-Pro200</td><td></td></tr><tr><td>2-20 &micro;L pipette</td><td>Kirgen</td><td>KG-Pro20</td><td></td></tr><tr><td>4x Gel Loading Dye</td><td>Evrogen</td><td>PB020</td><td></td></tr><tr><td>Acrylamide 4K</td><td>AppliChem</td><td>A1090,0500</td><td></td></tr><tr><td>Ammonium persulfate</td><td>Carl Roth</td><td>2809447</td><td></td></tr><tr><td>Biorender</td><td>Biorender</td><td></td><td>https://www.biorender.com</td></tr><tr><td>Bisacrylamide</td><td>Molekula</td><td>22797959</td><td></td></tr><tr><td>Boric Acid</td><td>TechSnab</td><td>H-0202</td><td></td></tr><tr><td>ChemiDoc imaging system</td><td>BioRad</td><td>12003153</td><td></td></tr><tr><td>Costar 96-Well Black Polystyrene Plate</td><td>Corning</td><td>COS3915</td><td></td></tr><tr><td>DinaMelt</td><td>RNA Institute</td><td></td><td>http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php</td></tr><tr><td>EDTA</td><td>Amresco</td><td>Am-O105</td><td></td></tr><tr><td>Ethidium bromide</td><td>BioLabMix</td><td>EtBr-10</td><td></td></tr><tr><td>HEPES</td><td>Amresco</td><td>Am-O485</td><td></td></tr><tr><td>Magnesium chloride</td><td>AppliChem</td><td>131396</td><td></td></tr><tr><td>Mini Protean Tetra Cell</td><td>BioRad</td><td>1658001EDU</td><td></td></tr><tr><td>pipette 10 &micro;L tips</td><td>Kirgen</td><td>KG1111-L</td><td></td></tr><tr><td>pipette 1000 &micro;L tips</td><td>Kirgen</td><td>KG1636</td><td></td></tr><tr><td>pipette 200 &micro;L tips</td><td>Kirgen</td><td>KG1212-L</td><td></td></tr><tr><td>Pixelmator Pro</td><td>Pixelmator Team</td><td></td><td>https://www.pixelmator.com/pro/</td></tr><tr><td>Potassium chloride</td><td>Carl Roth</td><td>1782751</td><td></td></tr><tr><td>PowerPac Basic Power Supply</td><td>BioRad</td><td>1645050</td><td></td></tr><tr><td>RNAse/DNAse free water</td><td>Invitrogen</td><td>10977049</td><td></td></tr><tr><td>Sealing film for PCR plates</td><td>Sovtech</td><td>P-502</td><td></td></tr><tr><td>Sodium chloride</td><td>Vekton</td><td>HCh (0,1)</td><td></td></tr><tr><td>Spark multimode microplate reader</td><td>Tecan</td><td>Spark- 10M</td><td></td></tr><tr><td>T100 amplificator</td><td>BioRad</td><td>10014822</td><td></td></tr><tr><td>TEMED</td><td>Molekula</td><td>68604730</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane</td><td>Amresco</td><td>Am-O497</td><td></td></tr><tr><td>UNAFold</td><td>RNA Institute</td><td></td><td>http://www.unafold.org/mfold/applications/dna-folding-form.php</td></tr><tr><td>Water bath</td><td>LOIP</td><td>LB-140</td><td></td></tr><tr><td>Oligos used</td><td></td><td></td><td></td></tr><tr><td>Analyte:</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>GAGCACTTGGTCAGGCACACGG ACAGGGTCAGCGGAGGACGCG TGGCACAGCAGCCCGGGGTAG GTCCCCTGGACCTGCCGCTGG CGGACTACGCCTTCGTTGC</td><td></td><td></td><td></td></tr><tr><td>Tile-Arm3:</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>CCG GGCTGCTGTGCCATTTT TTGCTGACTACTGTCACCTCT CTGCTAGTCT</td><td></td><td></td><td></td></tr><tr><td>Dzb-Tile: AGACTAGCAGAGAGGTGACAG TAGTCAGCTTTTTTCGCGTCCTC CGCTGACCACAACGAGAGGAA ACCTT</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>Dza: TGCCCAGGGAGGCTAGCTCT GTCCGTGTGCCTGACCA</td><td>Evrogen</td><td></td><td>direct order, standard desalting purification</td></tr><tr><td>F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU CCCTGGGCA-BHQ1</td><td>DNA-Syntez</td><td></td><td>direct order, HPLC purification</td></tr></tbody></table>

dnazyme 10-23 - op basis van nanomachines voor nucleïnezuurherkenning

DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

DNAzyme 10-23 - Op basis van nanomachines voor nucleïnezuurherkenning

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their ...

dnazyme-10-23-based-nanomachines-for-nucleic-acid-recognition

Research

JoVE Journal

Biochemistry

Biochemie

Tonen we de montage en de toepassing van een moleculaire schaal apparaat aangedreven door een topoisomerase eiwit. Het construct is een bio-moleculaire sensor die twee belangrijke soorten van DNA breuken in weefselcoupes labels door het aanbrengen van twee verschillende fluoroforen om hun doel.

In vitro Vergadering van Semi-kunstmatige moleculaire machine en het gebruik ervan voor de detectie van DNA-schade

We hebben onlangs melding gemaakt van een nieuwe benadering voor het genereren van fluorogene DNAzyme probes die kan worden toegepast op het opzetten van een eenvoudige, "mix-and-lezen" TL-test voor bacteriële detectie. Deze speciale DNA probes katalyseren de splitsing van een chromofoor gemodificeerde DNA-RNA chimère substraat in aanwezigheid van ruwe extracellulaire mengsel (CEM) door een bepaald bacterie, waardoor vertaling bacteriële detectie in fluorescentiesignaal generatie. In dit...

Detectie van bacteriën met behulp van fluorogene DNAzymes

DNA origami is een krachtige methode voor het fabriceren van nauwkeurige objecten op nanoschaal door het zelfsamenstellen van DNA-moleculen te programmeren. Hier beschrijven we een protocol voor het vouwen van een bio-responsieve robot uit DNA origami, de zuivering en negatieve kleuring voor transmissie-elektronenmicroscopische beeldvorming (TEM).

Vouwen en Karakterisatie van een Bio-responsieve Robot van DNA Origami

De hierin beschreven protocol heeft tot doel uit te leggen en verkorten de vele obstakels in de weg van de ingewikkelde route die leidt tot gewijzigde nucleosidetrifosfaten. Bijgevolg Dit protocol maakt zowel de synthese van deze geactiveerde bouwstenen en hun beschikbaarheid voor praktische toepassingen.

Nucleosidetrifosfaten - Van Synthese tot biochemische karakterisering

Optische pincetten zijn gebruikt om RNA-vouwing te bestuderen door individuele moleculen uit te rekken vanaf hun 5’ en 3’ uiteinden. Hier worden gebruikelijke procedures beschreven voor het synthetiseren van RNA-moleculen voor tweezing, kalibratie van het instrument en methoden om enkele moleculen te manipuleren.

Nanomanipulatie van Single RNA-moleculen door een optisch pincet

Semiflexible polymeren weer unieke mechanische eigenschappen die uitgebreid door levende systemen worden toegepast. Systematische studies over biopolymeren zijn echter beperkt omdat eigenschappen zoals polymeer rigiditeit niet toegankelijk zijn. Dit manuscript wordt beschreven hoe is deze beperking omzeild door programmeerbare DNA nanobuisjes, waardoor experimentele studies over de gevolgen van de stijfheid van de gloeidraad.

DNA Nanotubes als een veelzijdig instrument om te studeren van Semiflexible polymeren

We melden de protocollen voor de synthese en zuivering van Peptide Nucleic Acid (PNA) oligomeren opnemen gewijzigd residuen. De biochemische en Biofysische methoden voor de karakterisatie van de erkenning van RNA duplexen door de gewijzigde PNAs worden beschreven.

Volgorde-specifieke en selectieve erkenning van Double-stranded RNAs over Single-stranded RNAs van chemisch gewijzigd Peptide nucleïnezuren

Hier presenteren we een protocol voor DNAzyme-afhankelijke splijting van RNA. Dit maakt een snelle en site-afhankelijke analyse van RNA 2 '-O-Methylation mogelijk. Deze aanpak kan worden gebruikt voor de voorlopige of belangrijke beoordeling van de activiteit van snoRNA.

DNAzyme-afhankelijke analyse van rRNA 2 '-O-methylatie

Veranderde Nuclease activiteit is in verband gebracht met verschillende menselijke omstandigheden, die onderliggende zijn potentieel als een biomarker. De modulaire en eenvoudig te implementeren screenings methodiek die in dit document wordt gepresenteerd, maakt het mogelijk specifieke nucleïnezuur voelers te selecteren voor het benutten van Nuclease activiteit als een biomarker van de ziekte.

Kinetische screening van Nuclease activiteit met behulp van nucleïnezuur sondes

Hier beschrijven we een protocol om discrete en nauwkeurige anorganische nanostructuren op substraten te maken met behulp van DNA-origami vormen als leidende templates. De methode wordt aangetoond door het creëren van plasmonic gouden bowtie-vormige antennes op een transparante ondergrond (Sapphire).

DNA origami-gemedieerde substraat nano-Atterning van anorganische structuren voor sensing toepassingen

Hier wordt een protocol gepresenteerd voor het bepalen van nucleïnezuurmetaboliserende enzymen, met behulp van voorbeelden van ligase-, nuclease- en polymerase-enzymen. De test maakt gebruik van fluorescerend gelabelde en niet-gelabelde oligonucleotiden die kunnen worden gecombineerd om duplexen te vormen die RNA- en/of DNA-schade of tussenproducten van de route nabootsen, waardoor het enzymgedrag kan worden gekarakteriseerd.

Gebruik van gemodificeerde synthetische oligonucleotiden om nucleïnezuurmetaboliserende enzymen te testen

Leer DNAzyme-gebaseerde nanomachines ontwerpen voor nucleïnezuurherkenning met behulp van gratis software. Deze methode toont hoge selectiviteit bij de detectie van virale fragmenten zoals Epstein-Barr.

DNAzyme 10-23 - Op basis van nanomachines voor nucleïnezuurherkenning

Meer video's verkennen