Name: Chemogenetische regulatie in geherprogrammeerde stamcel-afgeleide voorlopercellen bij de behandeling van neurodegeneratieve ziekten (Video) | JoVE Journal
Uploaded: 2025-05-02T14:00:00.000+00:00
Duration: 9 min 44 s
Description: Ontdek chemogenetische regulatie van stamcel-afgeleide dopaminerge voorlopercellen in muismodellen voor Parkinson. Deze methode maakt gedrags- en elektrofysiologische evaluatie van neurale activiteit mogelijk.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Thiel, G. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aThiel%2C+G+%22Designer+receptors+exclusively+activated+by+designer+drugs%22">Designer receptors exclusively activated by designer drugs</a>. , Humana Press. (2015).</li>
<li>Roth, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dreadds+for+neuroscientists%5BTitle%5D)+AND+%22Neuron%22%5BJournal%5D)">Dreadds for neuroscientists.</a> Neuron. 89 (4), 683-694 (2016).</li>
<li>Gomez, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemogenetics+revealed%3A+DREADD+occupancy+and+activation+via+converted+clozapine%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Chemogenetics revealed: DREADD occupancy and activation via converted clozapine.</a> Science. 357 (6350), 503-507 (2017).</li>
<li>Chehelgerdi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exploring+the+promising+potential+of+induced+pluripotent+stem+cells+in+cancer+research+and+therapy%5BTitle%5D)+AND+%22Mol+Cancer%22%5BJournal%5D)">Exploring the promising potential of induced pluripotent stem cells in cancer research and therapy.</a> Mol Cancer. 22 (1), 189(2023).</li>
<li>Song, J., Patel, R. V., Sharif, M., Ashokan, A., Michaelides, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemogenetics+as+a+neuromodulatory+approach+to+treating+neuropsychiatric+diseases+and+disorders%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">Chemogenetics as a neuromodulatory approach to treating neuropsychiatric diseases and disorders.</a> Mol Ther. 30 (3), 990-1005 (2022).</li>
<li>Parmar, M., Grealish, S., Henchcliffe, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+future+of+stem+cell+therapies+for+Parkinson+disease%5BTitle%5D)+AND+%22Nat+Rev+Neurosci%22%5BJournal%5D)">The future of stem cell therapies for Parkinson disease.</a> Nat Rev Neurosci. 21 (2), 103-115 (2020).</li>
<li>Dell'anno, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Remote+control+of+induced+dopaminergic+neurons+in+Parkinsonian+rats%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Remote control of induced dopaminergic neurons in Parkinsonian rats.</a> J Clin Invest. 124 (7), 3215-3229 (2014).</li>
<li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemical+control+of+grafted+human+PSC-derived+neurons+in+a+mouse+model+of+Parkinson%27s+disease%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Chemical control of grafted human PSC-derived neurons in a mouse model of Parkinson's disease.</a> Cell Stem Cell. 18 (6), 817-826 (2016).</li>
<li>Bjorklund, A., Parmar, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dopamine+cell+therapy%3A+From+cell+replacement+to+circuitry+repair%5BTitle%5D)+AND+%22J+Parkinsons+Dis%22%5BJournal%5D)">Dopamine cell therapy: From cell replacement to circuitry repair.</a> J Parkinsons Dis. 11 (S2), S159-S165 (2021).</li>
<li>Alcacer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemogenetic+stimulation+of+striatal+projection+neurons+modulates+responses+to+Parkinson%27s+disease+therapy%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Chemogenetic stimulation of striatal projection neurons modulates responses to Parkinson's disease therapy.</a> J Clin Invest. 127 (2), 720-734 (2017).</li>
<li>Alexander, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Remote+control+of+neuronal+activity+in+transgenic+mice+expressing+evolved+G+protein-coupled+receptors%5BTitle%5D)+AND+%22Neuron%22%5BJournal%5D)">Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors.</a> Neuron. 63 (1), 27-39 (2009).</li>
<li>Stachniak, T. J., Ghosh, A., Sternson, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemogenetic+synaptic+silencing+of+neural+circuits+localizes+a+hypothalamus+midbrain+pathway+for+feeding+behavior%5BTitle%5D)+AND+%22Neuron%22%5BJournal%5D)">Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus midbrain pathway for feeding behavior.</a> Neuron. 82 (4), 797-808 (2014).</li>
<li>Kang, H. J., Minamimoto, T., Wess, J., Roth, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemogenetics+for+cell-type-specific+modulation+of+signalling+and+neuronal+activity%5BTitle%5D)+AND+%22Nat+Rev+Methods+Primers%22%5BJournal%5D)">Chemogenetics for cell-type-specific modulation of signalling and neuronal activity.</a> Nat Rev Methods Primers. 3 (1), 93(2023).</li>
<li>Miyanishi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Behavioral+tests+predicting+striatal+dopamine+level+in+a+rat+hemi-Parkinson%27s+disease+model%5BTitle%5D)+AND+%22Neurochem+Int%22%5BJournal%5D)">Behavioral tests predicting striatal dopamine level in a rat hemi-Parkinson's disease model.</a> Neurochem Int. 122, 38-46 (2019).</li>
<li>Zheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+IPSC-derived+midbrain+organoids+functionally+integrate+into+striatum+circuits+and+restore+motor+function+in+a+mouse+model+of+Parkinson%27s+disease%5BTitle%5D)+AND+%22Theranostics%22%5BJournal%5D)">Human IPSC-derived midbrain organoids functionally integrate into striatum circuits and restore motor function in a mouse model of Parkinson's disease.</a> Theranostics. 13 (8), 2673-2692 (2023).</li>
<li>Xiong, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+stem+cell-derived+neurons+repair+circuits+and+restore+neural+function%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Human stem cell-derived neurons repair circuits and restore neural function.</a> Cell Stem Cell. 28 (1), 112-126.e6 (2021).</li>
<li>Yuan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dopaminergic+precursors+differentiated+from+human+blood-derived+induced+neural+stem+cells+improve+symptoms+of+a+mouse+Parkinson%27s+disease+model%5BTitle%5D)+AND+%22Theranostics%22%5BJournal%5D)">Dopaminergic precursors differentiated from human blood-derived induced neural stem cells improve symptoms of a mouse Parkinson's disease model.</a> Theranostics. 8 (17), 4679(2018).</li>
<li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Preparation+of+acute+spinal+cord+slices+for+whole-cell+patch-clamp+recording+in+substantia+gelatinosa+neurons%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Preparation of acute spinal cord slices for whole-cell patch-clamp recording in substantia gelatinosa neurons.</a> J Vis Exp. (143), (2019).</li>
<li>Wang, X., Han, D., Zheng, T., Ma, J., Chen, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modulation+of+human+induced+neural+stem+cell-derived+dopaminergic+neurons+by+DREADD+reveals+therapeutic+effects+on+a+mouse+model+of+Parkinson%27s+disease%5BTitle%5D)+AND+%22Stem+Cell+Res+Ther%22%5BJournal%5D)">Modulation of human induced neural stem cell-derived dopaminergic neurons by DREADD reveals therapeutic effects on a mouse model of Parkinson's disease.</a> Stem Cell Res Ther. 15 (1), 297(2024).</li>
<li>Iancu, R., Mohapel, P., Brundin, P., Paul, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Behavioral+characterization+of+a+unilateral+6-OHDA-lesion+model+of+Parkinson%27s+disease+in+mice%5BTitle%5D)+AND+%22Behav+Brain+Res%22%5BJournal%5D)">Behavioral characterization of a unilateral 6-OHDA-lesion model of Parkinson's disease in mice.</a> Behav Brain Res. 162 (1), 1-10 (2005).</li>
<li>Surmeier, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+dopamine+in+modulating+the+structure+and+function+of+striatal+circuits%5BTitle%5D)+AND+%22Prog+Brain+Res%22%5BJournal%5D)">The role of dopamine in modulating the structure and function of striatal circuits.</a> Prog Brain Res. 183, 148-167 (2010).</li>
</ol>

<table><tbody><tr><td>2 x Rapid Taq Master Mix</td><td>Vazyme</td><td>P222-01</td><td>gebruikt voor genotyperinganalyse</td></tr><tr><td>2&times;Seamless Cloning Mix</td><td>Biomed Gene Tech.</td><td>CL117-01</td><td>gebruikt voor plasmideconstructie</td></tr><tr><td>6-OHDA</td><td>Sigma-Aldrich</td><td>H4381</td><td>gebruikt voor het opzetten van PD-muizenmodel</td></tr><tr><td>AAVS1-Pur-CAG-EGFP</td><td>Addgene</td><td>80945</td><td>gebruikt als controle&nbsp;</td></tr><tr><td>AAVS1-Pur-CAG-hM4Di-mCherry</td><td>Addgene</td><td>80947</td><td>originele plasmide voor constructie van hM4Di-T2A-ZsGreen</td></tr><tr><td>AAVS1-Pur-CAG-hM3Dq-mCherry</td><td>Addgene</td><td>80948</td><td>originele plasmide voor constructie van hM3Dq-T2A-ZsGreen</td></tr><tr><td>AAVS1-CAG-hM4Di-T2A-ZsGreen</td><td>N/A</td><td>N/A</td><td>Geconstrueerd donorplasmide op basis van #80947</td></tr><tr><td>AAVS1-CAG-hM3Dq-T2A-ZsGreen</td><td>N/A</td><td>N/A</td><td>Geconstrueerd donorplasmide op basis van #80948</td></tr><tr><td>Accutase</td><td>Invitrogen</td><td>A11105-01</td><td>Gebruikt voor het verteren van cellen</td></tr><tr><td>AMAXA Nucleofector</td><td>Lonza</td><td>AAD-1001S</td><td></td></tr><tr><td>Apomorphine</td><td>Sigma-Aldrich</td><td>A4393</td><td></td></tr><tr><td>Kunstmatig hersenvocht (ACSF)</td><td>N/A</td><td>N/A</td><td>125 mM NaCl, 2,5 mM KCl, 2 mM CaCl2, 1,25 mM NaH2PO4, 1 mM MgSO4, 25 mM glucose, en&nbsp; 26 mM NaHCO3</td></tr><tr><td>Ascorbinezuur</td><td>Sigma-Aldrich</td><td>1043003</td><td></td></tr><tr><td>B-27 Supplement</td><td>Gibco</td><td>17504044</td><td></td></tr><tr><td>BDNF</td><td>Peprotech</td><td>450-02</td><td></td></tr><tr><td>cAMP</td><td>Sigma-Aldrich</td><td>D0627</td><td></td></tr><tr><td>CHIR99021</td><td>Yeasen</td><td>53003ES10</td><td></td></tr><tr><td>Clozapine-N-oxide</td><td>Enzo</td><td>BML-NS105</td><td></td></tr><tr><td>DAPT</td><td>Sigma-Aldrich</td><td>D5942</td><td></td></tr><tr><td>Desipramine&nbsp;</td><td>Sigma-Aldrich</td><td>D3900</td><td></td></tr><tr><td>D-glucose</td><td>Sigma-Aldrich</td><td>G5767</td><td></td></tr><tr><td>DMEM/F12</td><td>Gibco</td><td>11330-032</td><td></td></tr><tr><td>DMEM/F12</td><td>Gibco</td><td>11320-033</td><td></td></tr><tr><td>DMSO</td><td>Sigma-Aldrich</td><td>D2650</td><td></td></tr><tr><td>FGF8</td><td>Peprotech</td><td>100-25</td><td></td></tr><tr><td>GDNF</td><td>Peprotech</td><td>450-10</td><td></td></tr><tr><td>GlutaMax</td><td>Gibco</td><td>35050-061</td><td></td></tr><tr><td>Hank&rsquo;s Balanced Salt Solution (HBSS)</td><td>Gibco</td><td>14175095</td><td></td></tr><tr><td>Human leukemia inhibitory factor (hrLIF)</td><td>Millipore</td><td>LIF1010</td><td></td></tr><tr><td>Iced intracellulair vocht</td><td>N/A</td><td>N/A</td><td>130 mM K-gluconaat, 16 mM KCl, 0,2 mM EGTA, 2 mM MgCl2, 10 mM HEPES, 4 mM Na2-ATP, 0,4 mM Na3-GTP, 0,3% neurobiotine</td></tr><tr><td>KnockOut Serum Replacement</td><td>Gibco</td><td>10828028</td><td></td></tr><tr><td>Laminine</td><td>Roche</td><td>11243217001</td><td></td></tr><tr><td>Micropipet Puller</td><td>Sutter Instrument Company</td><td>P-1000</td><td></td></tr><tr><td>N-2 Supplement</td><td>Thermo Fisher</td><td>17502048</td><td></td></tr><tr><td>Neurobasal-A Medium</td><td>Gibco</td><td>10888-022</td><td></td></tr><tr><td>Non-essentiële aminozuren (NEAA)</td><td>Gibco</td><td>11140-050</td><td></td></tr><tr><td>PBS</td><td>Gibco</td><td>10010023</td><td></td></tr><tr><td>pCLAMP 11 software suite</td><td>Molecular Devices</td><td>N/A</td><td>Patch-clamp elektrofysiologie gegevensverzameling en analysesoftware</td></tr><tr><td>Differentiatiemedium fase 1</td><td>N/A</td><td>N/A</td><td>96% DMEM/F12 (Gibco, 11320-033), 1% B-27 Supplement, 1% N-2 Supplement, 1% NEAA, 1% GlutaMax, 1 µM SAG1, en 100 ng/mL FGF8&nbsp;</td></tr><tr><td>Differentiatiemedium fase 2&nbsp;</td><td>N/A</td><td>N/A</td><td>96% DMEM/F12 (Gibco, 11320-033), 1% B-27 Supplement, 1% N-2 Supplement, 1% NEAA, en 1% GlutaMax, 10 ng/mL BDNF, 10 ng/mL GDNF, 1 ng/mL TGF-βIII, 10 µM DAPT, 0,2 mM ascorbinezuur, en 0,5 mM cAMP.</td></tr><tr><td>Poly-D-lysine hydrobromide (PDL)</td><td>Sigma-Aldrich</td><td>P7886</td><td></td></tr><tr><td>Primers voor genotypering</td><td>N/A</td><td>N/A</td><td>Insertion Foward: TCTTCACTCGCTGGGTTCCCTT; Insertion Reverse: CCTGTGGGAGGAAGAGAAGAGGT; Homozygosity Foward:CGTCTCCCTGGCTTTAGCCA; Homozygosity Reverse: GATCCTCTCTGGCTCCATCG</td></tr><tr><td>pX458</td><td>Addgene</td><td>152199</td><td></td></tr><tr><td>SAG1</td><td>Enzo</td><td>ALX-270-426-M01</td><td></td></tr><tr><td>SB431542</td><td>Yeasen</td><td>53004ES50</td><td></td></tr><tr><td>Sucrosegereed kunstmatig hersenvocht (s-ACSF)</td><td></td><td></td><td>234 mM sucrose, 2,5 mM KCl, 26 mM NaHCO3, 1,25 mM NaH2PO4, 11 mM Dglucose, 0,5 mM CaCl2, en 10 mM MgSO4</td></tr><tr><td>Stamcellenkweekmedium</td><td>N/A</td><td>N/A</td><td>&nbsp;48% DMEM/F12 (Gibco, 11330-032) en 48% Neurobasal, met de toevoeging van 1% B27, 1% N2, 1% NEAA, 1% GlutaMax, 10 ng/mL hrLIF, 2 µM SB431542, en 3 µM CHIR99021</td></tr><tr><td>TGF-βIII</td><td>Peprotech</td><td>100-36E</td><td></td></tr><tr><td>Transplantatiebuffer</td><td>

chemogenetische regulatie in geherprogrammeerde stamcel-afgeleide voorlopercellen bij de behandeling van neurodegeneratieve ziekten

Chemogenetic Regulation in Reprogrammed Stem Cell-derived Precursor Cells in Treating Neurodegenerative Diseases

Chemogenetische regulatie in geherprogrammeerde stamcel-afgeleide voorlopercellen bij de behandeling van neurodegeneratieve ziekten

The integration of designer receptors exclusively activated by designer drugs (DREADD) with stem cell-based therapies presents an advanced strategy for ...

chemogenetic-regulation-reprogrammed-stem-cell-derived-precursor

Research

JoVE Journal

Neuroscience

Neurowetenschap

Corticale Neurogenese: Overstappen van Vooruitgang in het Laboratorium voor Cell-gebaseerde therapieën

This video demonstrates the direct reprogramming of genetically modified hematopoietic progenitor cells into neuronal stem cells. Transcription factors expressed by hematopoietic progenitor cells trigger a cascade of molecular events facilitating their transformation. Further specific media is used to select and grow induced neuronal stem cells.

Direct Reprogramming of Hematopoietic Progenitor Cells into Neural Stem Cells

Source: Sharma, A. D., et.al. High Throughput Characterization of Adult Stem Cells Engineered for Delivery of Therapeutic Factors for Neuroprotective Strategies. J. Vis. Exp. (2015)This video demonstrates the process of characterizing transgenic mesenchymal stem cells engineered to express therapeutic neurotrophic factors. It outlines the steps involved in fixing, permeabilizing, and staining the cells with primary and secondary antibodies targeting a cell proliferation marker, followed by...

Characterization of Genetically Engineered Mesenchymal Stem Cells for Neurotherapeutic Applications

Dit protocol beschrijft een nieuwe mechanische snij methode die de sferische expansie van neurale stamcellen en voorlopercellen aggregaten zonder dissociatie een enkele celsuspensie maakt. Handhaving van cel / cel contact maakt een snelle en stabiele groei voor meer dan 40 passages.

Een cGMP-toepassing Uitbreiding Methode voor Aggregaten van menselijke neurale stamcellen en stamcellen afgeleid uit pluripotente stamcellen of foetaal hersenweefsel

Deze studie beschrijft een experimenteel platform om snel gemanipuleerde stamcellen en hun gedrag te karakteriseren voordat ze worden toegepast in langetermijn in vivo transplantatiestudies voor redding en herstel van het zenuwstelsel.

Hoge doorvoer analyse van volwassen stamcellen ontwikkeld voor toediening van therapeutische factoren voor Neuroprotective Strategies

Generatie van geïnduceerde pluripotente stamcellen biedt fascinerende perspectieven voor de afleiding van autologe transplantaties. Echter, de progressie door middel van een pluripotente toestand en moeizaam re-differentiatie nog belemmert klinische vertaling. Hier beschrijven we de afleiding van volwassen humane fibroblasten en hun directe omzetting in geïnduceerde neurale progenitor cellen en de daaropvolgende differentiatie tot neuronale lijnen.

Afleiding van volwassen menselijke fibroblasten en hun directe omzetting in Expandable Neural Progenitor Cellen

Directe neuronale herprogrammering genereert neuronen die de leeftijd van de begincel van somatische handhaven. Hier beschrijven we een enkele vector-gebaseerde methode voor het genereren van geïnduceerde neuronen van dermale fibroblasten van volwassen menselijke donors verlangde.

Eenvoudige generatie van de cultuur van een hoog rendement van geïnduceerde neuronen van menselijke volwassen huid fibroblasten

Het protocol presenteert de herprogrammering van perifere bloed mononucleaire cellen voor het opwekken van neurale stamcellen door Sendai virus infectie, differentiatie van iNSCs in Dopaminerge neuronen, transplantatie van de voorlopers van de DA in de eenzijdig-lesioned De ziekte van Parkinson, en de evaluatie van de veiligheid en werkzaamheid van de in de SC afgeleide DA-precursoren voor PD-behandeling.

Generatie van geïnduceerde neurale stamcellen uit perifere mononucleaire cellen en differentiatie naar precursoren voor Dopaminerge neuron voor transplantatie studies

We presenteren een genetisch gemodificeerde vrije (GM-vrije) methode om cellen met een neuronaal fenotype te verkrijgen uit geherprogrammeerde perifere bloedcellen. Activering van een signaleringsroute gekoppeld aan nieuwe menselijke GPI-gebonden eiwitten onthult een efficiënte GM-vrije methode voor het verkrijgen van menselijke pluripotente stamcellen.

GM-vrije generatie van bloed-afgeleide neuronale cellen

We beschrijven een protocol om menselijke huid-afgeleide fibroblasten te herprogrammeren in geïnduceerde Neuronal Progenitor Cells (iNPC's), en hun daaropvolgende differentiatie in geïnduceerde Astrocyten (iA's). Deze methode leidt tot een snelle en reproduceerbare generatie van iNPC's en iA's in grote hoeveelheden.

In vitro modellering voor neurologische ziekten met behulp van directe conversie van fibroblasten naar neuronale voorlopercellen en differentiatie in astrocyten

Transplantatie van menselijke pluripotente stamcel-afgeleide GABAerge neuronen gegenereerd door neuronale programmering zou een potentiële behandelingsbenadering kunnen zijn voor neurologische ontwikkelingsstoornissen. Dit protocol beschrijft de generatie en transplantatie van menselijke stamcel-afgeleide GABAerge neuronale voorlopers in de hersenen van neonatale muizen, waardoor langdurig onderzoek van geënte neuronen en evaluatie van hun therapeutisch potentieel mogelijk is.

Transplantatie van menselijke stamcel-afgeleide GABAerge neuronen in de vroege postnatale muis hippocampus om neurologische ontwikkelingsstoornissen te verminderen

Ontdek chemogenetische regulatie van stamcel-afgeleide dopaminerge voorlopercellen in muismodellen voor Parkinson. Deze methode maakt gedrags- en elektrofysiologische evaluatie van neurale activiteit mogelijk.

Chemogenetische regulatie in geherprogrammeerde stamcel-afgeleide voorlopercellen bij de behandeling van neurodegeneratieve ziekten (Video) | JoVE Journal

Chemogenetische regulatie in geherprogrammeerde stamcel-afgeleide voorlopercellen bij de behandeling van neurodegeneratieve ziekten

Meer video's verkennen