Name: Laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor RNA-analyse (Video) | JoVE Journal
Uploaded: 2026-04-17T12:33:00.000+00:00
Duration: 9 min 21 s
Description: Leer laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor RNA-analyse. Deze methode isoleert specifieke histologische regio's met hoge RNA-pureheid voor transcriptoomonderzoek.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Shapiro, E., Biezuner, T., Linnarsson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing-based+technologies+will+revolutionize+whole-organism+science%5BTitle%5D)+AND+%22Nat+Rev+Genet%22%5BJournal%5D)">Single-cell sequencing-based technologies will revolutionize whole-organism science.</a> Nat Rev Genet. 14 (9), 618-630 (2013).</li>
<li>Halpern, K. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+spatial+reconstruction+reveals+global+division+of+labour+in+the+mammalian+liver%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Single-cell spatial reconstruction reveals global division of labour in the mammalian liver.</a> Nature. 543 (7647), 352-356 (2017).</li>
<li>Aizarani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+human+liver+cell+atlas+reveals+heterogeneity+and+epithelial+progenitors%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">A human liver cell atlas reveals heterogeneity and epithelial progenitors.</a> Nature. 572 (7768), 199-204 (2019).</li>
<li>Van Den Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing+reveals+dissociation-induced+gene+expression+in+tissue+subpopulations%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Single-cell sequencing reveals dissociation-induced gene expression in tissue subpopulations.</a> Nat Methods. 14 (10), 935-936 (2017).</li>
<li>Baron, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+Type+Purification+by+Single-Cell+Transcriptome-Trained+Sorting%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Cell Type Purification by Single-Cell Transcriptome-Trained Sorting.</a> Cell. 179 (2), 527-542.e19 (2019).</li>
<li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Technologies+for+Single-Cell+Isolation%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Technologies for Single-Cell Isolation.</a> Int J Mol Sci. 16 (8), 16897-16919 (2015).</li>
<li>Dries, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Advances+in+spatial+transcriptomic+data+analysis%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Advances in spatial transcriptomic data analysis.</a> Genome Res. 31 (10), 1706-1718 (2021).</li>
<li>Chen, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatiotemporal+transcriptomic+atlas+of+mouse+organogenesis+using+DNA+nanoball-patterned+arrays%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Spatiotemporal transcriptomic atlas of mouse organogenesis using DNA nanoball-patterned arrays.</a> Cell. 185 (10), 1777-1792.e21 (2022).</li>
<li>Ståhl, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualization+and+analysis+of+gene+expression+in+tissue+sections+by+spatial+transcriptomics%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Visualization and analysis of gene expression in tissue sections by spatial transcriptomics.</a> Science. 353 (6294), 78-82 (2016).</li>
<li>Espina, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser-capture+microdissection%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Laser-capture microdissection.</a> Nat Protoc. 1 (2), 586-603 (2006).</li>
<li>Baba, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+expression+profiling+in+biliary+epithelial+cells+of+primary+biliary+cirrhosis+using+laser+capture+microdissection+and+cDNA+microarray%5BTitle%5D)+AND+%22Transl+Res%22%5BJournal%5D)">Gene expression profiling in biliary epithelial cells of primary biliary cirrhosis using laser capture microdissection and cDNA microarray.</a> Transl Res. 148 (3), 103-113 (2006).</li>
<li>Mena, J. E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection+after+%CE%B3-glutamyl+transferase+histochemistry%3A+An+optimization+for+gene+expression+analysis%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">Laser capture microdissection after γ-glutamyl transferase histochemistry: An optimization for gene expression analysis.</a> Anal Biochem. 447, 126-132 (2014).</li>
<li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-generation+RNA+Sequencing+of+Archival+Formalin-fixed+Paraffin-embedded+Urothelial+Bladder+Cancer%5BTitle%5D)+AND+%22Eur+Urol%22%5BJournal%5D)">Next-generation RNA Sequencing of Archival Formalin-fixed Paraffin-embedded Urothelial Bladder Cancer.</a> Eur Urol. 66 (6), 982-986 (2014).</li>
<li>Ludyga, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleic+acids+from+long-term+preserved+FFPE+tissues+are+suitable+for+downstream+analyses%5BTitle%5D)+AND+%22Virchows+Arch%22%5BJournal%5D)">Nucleic acids from long-term preserved FFPE tissues are suitable for downstream analyses.</a> Virchows Arch. 460 (2), 131-140 (2012).</li>
<li>Mägel, L., Bartels, S., Lehmann, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-Generation+Sequencing+Analysis+of+Laser-Microdissected+Formalin-Fixed+and+Paraffin-Embedded+%28FFPE%29+Tissue+Specimens%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Next-Generation Sequencing Analysis of Laser-Microdissected Formalin-Fixed and Paraffin-Embedded (FFPE) Tissue Specimens.</a> Methods Mol Biol. 1723, 111-118 (2018).</li>
<li>Von Ahlfen, S., Missel, A., Bendrat, K., Schlumpberger, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determinants+of+RNA+Quality+from+FFPE+Samples%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Determinants of RNA Quality from FFPE Samples.</a> PLoS One. 2 (12), e1261(2007).</li>
<li>Böhm, M., Wieland, I., Schütze, K., Rübben, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbeam+MOMeNT%3A+non-contact+laser+microdissection+of+membrane-mounted+native+tissue%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">Microbeam MOMeNT: non-contact laser microdissection of membrane-mounted native tissue.</a> Am J Pathol. 151 (1), 63-67 (1997).</li>
<li>Schütze, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cut+out+or+poke+in--the+key+to+the+world+of+single+genes%3A+laser+micromanipulation+as+a+valuable+tool+on+the+look-out+for+the+origin+of+disease%5BTitle%5D)+AND+%22Genet+Anal%22%5BJournal%5D)">Cut out or poke in--the key to the world of single genes: laser micromanipulation as a valuable tool on the look-out for the origin of disease.</a> Genet Anal. 14 (1), 1-8 (1997).</li>
<li>Datta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection%3A+Big+data+from+small+samples%5BTitle%5D)+AND+%22Histol+Histopathol%22%5BJournal%5D)">Laser capture microdissection: Big data from small samples.</a> Histol Histopathol. 30 (11), 1255-1269 (2015).</li>
<li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NanoDrop+microvolume+quantitation+of+nucleic+acids%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">NanoDrop microvolume quantitation of nucleic acids.</a> J Vis Exp. (45), e2565(2010).</li>
<li>Ge, S. J., Gan, W. Q., Karlinsey, K., Zhou, B. Y., Pachter, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immuno-laser+capture+microdissection+of+perfusion-fixed+mouse+brain+tissue+coupled+to+RNA-seq%5BTitle%5D)+AND+%22J+Neurosci+Methods%22%5BJournal%5D)">Immuno-laser capture microdissection of perfusion-fixed mouse brain tissue coupled to RNA-seq.</a> J Neurosci Methods. 423, 110548(2025).</li>
<li>Takahashi, K., Beltran, W. A., Sudharsan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimized+workflow+for+transcriptomic+analysis+from+archival+paraformaldehyde-fixed+retinal+tissues+collected+by+laser+capture+microdissection%5BTitle%5D)+AND+%22Exp+Eye+Res%22%5BJournal%5D)">An optimized workflow for transcriptomic analysis from archival paraformaldehyde-fixed retinal tissues collected by laser capture microdissection.</a> Exp Eye Res. 246, 109989(2024).</li>
<li>Mahalingam, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection%3A+Insights+into+Methods+and+Applications%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Laser Capture Microdissection: Insights into Methods and Applications.</a> Methods Mol Biol. 1723, 1-17 (2018).</li>
<li>Kim, S. O., Kim, J., Okajima, T., Cho, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanical+properties+of+paraformaldehyde-treated+individual+cells+investigated+by+atomic+force+microscopy+and+scanning+ion+conductance+microscopy%5BTitle%5D)+AND+%22Nano+Converg%22%5BJournal%5D)">Mechanical properties of paraformaldehyde-treated individual cells investigated by atomic force microscopy and scanning ion conductance microscopy.</a> Nano Converg. 4 (1), (2017).</li>
<li>Erickson, H. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+RT-PCR+gene+expression+analysis+of+laser+microdissected+tissue+samples%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Quantitative RT-PCR gene expression analysis of laser microdissected tissue samples.</a> Nat Protoc. 4 (6), 902-922 (2009).</li>
<li>Pan, D. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection-Based+RNA+Microsequencing+Reveals+Optic+Nerve+Crush-Related+Early+mRNA+Alterations+in+Retinal+Ganglion+Cell+Layer%5BTitle%5D)+AND+%22Transl+Vis+Sci+Technol%22%5BJournal%5D)">Laser Capture Microdissection-Based RNA Microsequencing Reveals Optic Nerve Crush-Related Early mRNA Alterations in Retinal Ganglion Cell Layer.</a> Transl Vis Sci Technol. 9 (11), 30(2020).</li>
<li>Civita, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection+and+RNA-Seq+Analysis%3A+High+Sensitivity+Approaches+to+Explain+Histopathological+Heterogeneity+in+Human+Glioblastoma+FFPE+Archived+Tissues%5BTitle%5D)+AND+%22Front+Oncol%22%5BJournal%5D)">Laser Capture Microdissection and RNA-Seq Analysis: High Sensitivity Approaches to Explain Histopathological Heterogeneity in Human Glioblastoma FFPE Archived Tissues.</a> Front Oncol. 9, 482(2019).</li>
<li>Phan, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+RNA+sequencing+of+paraformaldehyde-fixed+single+cells%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">High-throughput RNA sequencing of paraformaldehyde-fixed single cells.</a> Nat Commun. 12 (1), 5636(2021).</li>
<li>Thomsen, E. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fixed+single-cell+transcriptomic+characterization+of+human+radial+glial+diversity%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Fixed single-cell transcriptomic characterization of human radial glial diversity.</a> Nat Methods. 13 (1), 87-93 (2016).</li>
<li>Lin, X. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+comparative+analysis+of+RNA+sequencing+methods+with+ribosome+RNA+depletion+for+degraded+and+low-input+total+RNA+from+formalin-fixed+and+paraffin-embedded+samples%5BTitle%5D)+AND+%22Bmc+Genomics%22%5BJournal%5D)">A comparative analysis of RNA sequencing methods with ribosome RNA depletion for degraded and low-input total RNA from formalin-fixed and paraffin-embedded samples.</a> Bmc Genomics. 20 (1), 831(2019).</li>
<li>Luzzi, V., Mahadevappa, M., Raja, R., Warrington, J. A., Watson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Accurate+and+reproducible+gene+expression+profiles+from+laser+capture+microdissection%2C+transcript+amplification%2C+and+high+density+oligonucleotide+microarray+analysis%5BTitle%5D)+AND+%22J+Mol+Diagn%22%5BJournal%5D)">Accurate and reproducible gene expression profiles from laser capture microdissection, transcript amplification, and high density oligonucleotide microarray analysis.</a> J Mol Diagn. 5 (1), 9-14 (2003).</li>
</ol>

<table><tbody><tr><td>Materiaal</td><td></td><td></td><td></td></tr><tr><td>0.2 ml dunne buisjes</td><td>Axygen</td><td>PCR-02-C</td><td>Buisjes voor LCM-collectie</td></tr><tr><td>1.5 mL centrifugebuis</td><td>Axygen</td><td>339653</td><td></td></tr><tr><td>4% paraformaldehyde</td><td>Leagene</td><td>DF0135</td><td></td></tr><tr><td>50 mL centrifugebuis</td><td>ThermoFisher Scientific</td><td>339653</td><td></td></tr><tr><td>DEPC (diethylpyrocarbonaat)</td><td>Sigma</td><td>D-5758</td><td></td></tr><tr><td>DNase I-verteringsset</td><td>Qiagen</td><td>73504</td><td>Onderdeel van het RNeasy FFPE Kit, inclusief DNase I-stockoplossing en DNase Booster Buffer</td></tr><tr><td>Ethanol (100%)</td><td>Thermo Fisher Scientific</td><td>BP2818</td><td>Gezuiverd voor moleculaire biologie</td></tr><tr><td>Ethanol-gebaseerde wasbuffer</td><td>Qiagen</td><td>73504</td><td>Buffer RPE (onderdeel van RNeasy FFPE Kit)</td></tr><tr><td>Hoge zoutwasbuffer</td><td>Qiagen</td><td>73504</td><td>Buffer RBC (onderdeel van RNeasy FFPE Kit)</td></tr><tr><td>Microtoommessen met laag profiel</td><td>Leica Biosystems</td><td>819</td><td></td></tr><tr><td>Mayer&rsquo;s hematoxylinen</td><td>Leagene</td><td>DH0001</td><td></td></tr><tr><td>OCT-compound</td><td>Sakura</td><td>4583</td><td></td></tr><tr><td>PEN-membraan gecoate schuif</td><td>Leica</td><td>11505188</td><td></td></tr><tr><td>Fosfaat gebufferde zoutoplossing</td><td>Leagene</td><td>CC0010</td><td>Vrij van DNase/RNase</td></tr><tr><td>Poly-L-lysine</td><td>Macklin</td><td>P875131S</td><td></td></tr><tr><td>Proteïnase K-verteringsbuffer</td><td>Qiagen</td><td>73504</td><td>Buffer PKD (onderdeel van RNeasy FFPE Kit)</td></tr><tr><td>Zuiveringskolom</td><td>Qiagen</td><td>73504</td><td>RNeasy MinElute spinkolom (onderdeel van RNeasy FFPE Kit)</td></tr><tr><td>Kwantitatieve PCR mastermix</td><td>Takara Bio</td><td>RR820A</td><td>TB Green Premix Ex Taq II (Tli RNaseH Plus)</td></tr><tr><td>Omgekeerde transcriptie kit</td><td>Qiagen</td><td>205411</td><td>QuantiNova Reverse Transcriptie Kit</td></tr><tr><td>RNA-extractie kit</td><td>Qiagen</td><td>73504</td><td>RNeasy FFPE Kit</td></tr><tr><td>RNA Sequencing Kit (Low-input, Stranded)</td><td>Takara Bio</td><td>634412</td><td>SMARTer stranded total RNA-seq kit - pico input mammalian v2</td></tr><tr><td>RNase ontsmettingsmiddel</td><td>Solarbio</td><td>SR0040</td><td>Reiniging</td></tr><tr><td>Sucrose</td><td>Macklin</td><td>S818049</td><td></td></tr><tr><td>Dieren en dieet</td><td></td><td></td><td></td></tr><tr><td>Muis: C57BL/6J</td><td>Laboratory Animal Center of Guangdong Province</td><td>03</td><td></td></tr><tr><td>Speciaal dieet &amp; drinkwater</td><td></td><td></td><td></td></tr><tr><td>Hoogvet, choline-deficiënt dieet (basisdieet)</td><td>TROPHIC Animal Feed High-Tech Co., Ltd.</td><td>TP36310M</td><td>Macronutriënten: eiwit, 14 kcal%; koolhydraten, 26 kcal%; vet, 60 kcal%)</td></tr><tr><td>Suiker aangevuld drinkwater</td><td>Macklin</td><td>N/A (zelf bereid)</td><td>Een mengsel van D-glucose (Macklin, Cat# F87500) en D-fructose (Macklin, Cat# S818049) werd toegevoegd aan geautoclaveerd drinkwater met een uiteindelijke concentratie van 42 g/L, met een glucose-tot-fructose verhouding van 55:45 (w/w)</td></tr><tr><td>Muis Primers</td><td></td><td></td><td></td></tr><tr><td>&beta;-actine (Voorwaarts: AGAGGGAAATCGTGCGTGAC )</td><td>BGI Sequencing</td><td>Aangepast</td><td>HPLC gezuiverd</td></tr><tr><td>&beta;-actine (Omgekeerd: CAATAGTGATGACCTGGCCGT)</td><td>BGI Sequencing</td><td>Aangepast</td><td>HPLC gezuiverd</td></tr><tr><td>Apparatuur</td><td></td><td></td><td></td></tr><tr><td>Cryostat microtoom</td><td>Leica Biosystems</td><td>CM3050 S</td><td></td></tr><tr><td>Bioanalyzer systeem</td><td>Agilent</td><td>G2939BA</td><td></td></tr><tr><td>Hoge doorvoer sequencing platform</td><td>Illumina; Inc.</td><td>NovaSeq 6000 systeem</td><td></td></tr><tr><td>Laser Capture Microdissectie systeem</td><td>Leica Microsystems</td><td>Leica LMD6500</td><td></td></tr><tr><td>Kwantitatieve PCR systeem</td><td>Applied Biosystems</td><td>QuantStudio 5 Real-Time PCR Systeem</td><td></td></tr><tr><td>Spectrofotometer</td><td>ThermoFisher Scientific</td><td>NP80</td><td>NanoDrop</td></tr><tr><td>Thermische Cycler</td><td>BioRad</td><td>T100</td><td></td></tr><tr><td>Software</td><td></td><td></td><td></td></tr><tr><td>Adobe Illustrator CC 2019 (versie 23.0.2)</td><td>Adobe</td><td>https://www.adobe.com/products/illustrator.html</td><td></td></tr><tr><td>GraphPad Prism (versie 8.3.0)</td><td>GraphPad Software</td><td>https://www.graphpad.com</td><td></td></tr></tbody></table>

laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor rna-analyse

Laser Capture Microdissection of Paraformaldehyde-Fixed Mouse Liver Tissue for RNA Analysis

Laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor RNA-analyse

Laser capture microdissection (LCM) provides spatial access to specific cell populations within complex tissues through in situ visualization and ...

laser-capture-microdissection-paraformaldehyde-fixed-mouse-liver

Research

JoVE Journal

Biology

Biologie

RNA-expressieprofilering van specifieke hersenregio's bij muizen vereist een nauwkeurige en reproduceerbare strategie voor weefselverzameling. Hier wordt een protocol beschreven dat gebruikmaakt van zowel coronale hersensecties als microdissectie met behulp van een weefselpons. De opbrengst en kwaliteit van het totale RNA dat uit de resulterende monsters is verkregen, bevestigen het nut van de beschreven methode.

Niet-Laser Capture Microscopie Aanpak voor de Microdissection van Discrete Mouse Brain Regio&#39;s voor Totaal RNA isolatie en Downstream next-generation sequencing en Gene Expression Profiling

Genexpressie analyse van een subset van cellen in een specifiek weefsel vormt een grote uitdaging. In dit artikel wordt beschreven hoe u een hoge kwaliteit totaal RNA van een specifieke cel populatie te isoleren door het combineren van een snelle immunolabeling methode met lasermicrodissectie.

RNA isolatie van de Cel specifieke subpopulaties met behulp van laser-capture Microdissection Gecombineerd met Rapid immunolabeling

Hier beschrijven we een vereenvoudigd protocol voor microRNA (miRNA) expressieanalyses in gearchiveerde, formaline-gefixeerde, paraffine-ingeslagen (FFPE) of vers bevroren prostaatkanker (PCa) klinisch weefsel met behulp van kwantitatieve real-time PCR (RT-PCR) en in situ hybridisatie (ISH).

miRNA expressie analyses bij prostaatkanker Klinische Tissues

Het doel van dit protocol is om laser-capture micro-dissectie te gebruiken als een effectieve methode om pure populaties van celtypen te isoleren uit heterogene prostaatweefsels voor downstream RNA-analyse.

Laser-capture microdissectie van Human Prostatic Epithelium voor RNA-analyse

Hier beschrijven we een protocol voor een reproduceerbare laser vangt microdissection (LCM) voor het isoleren van trabecular gevlochten (TM) voor downstream RNA analyse. De mogelijkheid om het analyseren van wijzigingen in genexpressie in het Vertaalgeheugen zal helpen bij het begrijpen van de moleculaire mechanismen van TM-gerelateerde oogbeschadigingen en/of ziekten.

Laser vangt Microdissection voor zeer zuivere Trabecular Zitschalen van muis ogen gen expressie p.a.

We presenteren een robuuste, kosteneffectieve en flexibele methode voor het meten van veranderingen in hepatocyte nummer en nucleaire ploidy binnen vaste / cryopreserved weefsel monsters die geen flow cytometrie vereist. Onze aanpak biedt een krachtige monster-brede handtekening van de lever cytologie ideaal voor het bijhouden van de progressie van leverletsel en ziekte.

Een High-Throughput In Situ Methode voor schatting van Hepatocyte Nucleaire Ploidy in muizen

Een laser Capture microdissection (LCM)-protocol werd ontwikkeld om voldoende hoeveelheid kwalitatief hoogwaardig RNA te verkrijgen voor genexpressie analyse in botcellen. De huidige studie focust op de muis dijbeen secties. Het hier gerapporteerde LCM-protocol kan echter worden gebruikt om genexpressie in cellen van een hard weefsel te bestuderen.

Een laser Capture microdissection protocol dat hoge kwaliteit RNA oplevert van vers-bevroren muis botten

Vertalen van ribosoom affiniteits zuivering (trap) maakt snelle en efficiënte isolatie van celtypespecifieke vertalen mRNA. Hier demonstreren we een methode die hydrodynamische staart-ader injectie combineert in een muismodel van lever repopulatie en val om het uitdrukkings Profiel van het herbevolkende hepatocyten te onderzoeken.

Celtype-specifieke genexpressie profilering in de muis lever

Dit protocol beschrijft de laser Capture micro dissectie voor de isolatie van kraakbeen en bot uit verse bevroren delen van de muis embryo. Kraakbeen en botten kunnen snel worden gevisualiseerd door Cresylacetaat-Violet kleuring en precies worden verzameld om RNA van hoge kwaliteit te leveren voor transcriptomische analyse.

Laser Capture Microdissectie van de muis embryonale kraakbeen en bot voor genexpressie analyse

Laser microdissectie (LMD) is een gevoelige en zeer reproduceerbare techniek die kan worden gebruikt om paden die glioom heterogeniteit en invasie te bemiddelen blootleggen. Hier beschrijven we een geoptimaliseerd protocol om discrete gebieden te isoleren van glioomweefsel met behulp van laser LMD, gevolgd door transcriptomische analyse.

Laser Capture Microdissection of Glioma Subregions for Spatial and Molecular Characterization of Intratumoral Heterogeneity, Oncostreams, and Invasion

Hier gepresenteerd is een protocol voor laser-capture microdissection (LCM) van plantaardige weefsels. LCM is een microscopische techniek voor het isoleren van gebieden van weefsel op een contaminatievrije manier. De procedure omvat weefselfixatie, paraffine inbedding, sectioning, LCM en RNA extractie. RNA wordt gebruikt in de downstream weefselspecifieke, tijdelijk opgeloste analyse van transcripto's.

Laser-Capture Microdissection RNA-Sequencing voor ruimtelijke en temporale weefsel-specifieke genexpressie analyse in planten

Leer laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor RNA-analyse. Deze methode isoleert specifieke histologische regio's met hoge RNA-pureheid voor transcriptoomonderzoek.

Laservangstmicrodissectie van paraformaldehyde-gefixeerd muizenleverweefsel voor RNA-analyse

Meer video's verkennen