Subskrypcja JoVE jest wymagana do oglądania tego materiału. Zaloguj się lub rozpocznij bezpłatny okres próbny.

Artykuł metodologiczny

A Model of Piroxicam-Accelerated Enterocolitis in Interleukin-10 Knockout Mice for Studying Inflammation-Induced Metabolic Alterations

74 wyświetleń

DOI:

10.3791/71448

11 sierpnia 2026

W tym artykule

Podsumowanie

This protocol uses piroxicam to accelerate colitis development in the interleukin (IL-10)-knockout mouse model. The protocol ensures colitis synchronization, resulting in rigorous, reproducible results independent of sex, background strain, or vivarium conditions. It serves as a useful model for studying metabolic alterations during intestinal inflammation.

Streszczenie

Inflammatory bowel disease (IBD) is a chronic inflammatory disorder of the digestive tract affecting over 10 million individuals globally. While substantial research has focused on the immunologic mechanisms and consequences underlying IBD, less is understood about how mucosal inflammation contributes to metabolic dysregulation, including weight loss and reduced appetite. Here, the authors describe a mouse model of piroxicam-accelerated enterocolitis in interleukin-10-knockout (IL-10-KO) mice to study inflammation-induced metabolic dysregulation. IL-10-KO mice are known to develop spontaneous enterocolitis and have heightened susceptibility to enterocolitis triggered by infections or drugs. However, vivarium conditions and strain background have been reported as confounders in colitis development in this model. Piroxicam, a non-steroidal anti-inflammatory drug (NSAID), has been demonstrated to trigger or accelerate enterocolitis in animal models by increasing mucosal exposure to luminal bacteria. In this protocol, male and female IL-10-KO mice were fed a piroxicam-fortified diet in place of a regular chow diet. Food intake and body weight were measured daily to reflect whole-body metabolic alterations, along with clinical manifestations of enterocolitis such as diarrhea and rectal bleeding. The protocol is efficient and reproducible, inducing enterocolitis simultaneously in multiple mice, and allows assessment of metabolic dysregulation in an inflammatory bowel disease model. Further studies using this protocol may investigate the effects of enterocolitis on other components of metabolic dysregulation, such as energy expenditure and body composition, revealing broader connections between inflammatory bowel disease and host metabolism.

Wprowadzenie

Crohn’s disease and ulcerative colitis, collectively known as inflammatory bowel disease (IBD), are chronic autoimmune disorders of the gastrointestinal tract characterized by mucosal inflammation with clinical manifestations including abdominal pain, weight loss, hematochezia, and diarrhea. IBD affects millions of individuals worldwide, with the highest prevalence in Westernized societies1. In the US, it is estimated that over 3 million people are affected2,3, with rising incidence and prevalence, particularly among children and young individuals4,5.

The exact mechanisms underlying IBD pathogenesis remain incompletely understood, but the disease is widely thought to result from an exaggerated immune response to the intestinal microbiota in genetically susceptible individuals. Cytokines that modulate inflammatory responses play critical roles in maintaining gut homeostasis and in the development of IBD. Among these, interleukin-10 (IL-10) is a well-studied anti-inflammatory cytokine that helps maintain immunologic homeostasis in humans by regulating both innate and adaptive arms of immune response6,7. Notably, polymorphisms in IL-10 and its receptor (IL-10RA/B) have been identified in infants with very-early onset IBD (VEO-IBD), classically presenting with perianal disease within the first several months of life8. This association is further supported by large-scale exome sequencing of adult patients with Crohn’s disease, which identified IL-10RA as a disease susceptibility locus in non-monogenic IBD9. Furthermore, a non-genetic pathway involving IL-10 neutralizing antibodies has been described in VEO-IBD patients, further highlighting the importance of this pathway in maintaining mucosal immune homeostasis10.

Building on human studies implicating IL-10 in IBD, interleukin-10-knockout (IL-10-KO) mice have been developed as a model to study IL-10's role in IBD. IL-10-KO mice are known to develop spontaneous enterocolitis with an exaggerated CD4+ Th1 response to stimuli, typically beginning at 8–12 weeks of age11. However, the development of spontaneous enterocolitis in IL-10-KO mice can be unpredictable in the absence of an accelerating agent12,13,14, depending on genetic strain, microbiota composition, and housing conditions15,16. The use of a reliable protocol to induce colitis is critical for the IL-10-KO model to be practically useful. Prior studies have utilized non-steroidal anti-inflammatory drugs (NSAIDs) such as piroxicam to induce enterocolitis in IL-10-KO mice17,18. However, these studies have primarily focused on immunologic alterations, with relatively little emphasis on the effects of enterocolitis on metabolism or on the role of sex in colitis severity19. The authors herein describe the use of a piroxicam-fortified diet to induce enterocolitis in IL-10-KO mice and characterize metabolic dysregulation and mucosal inflammatory responses in this model using both male and female mice. This protocol measures body weight and food intake to reflect whole-body metabolic alterations, as well as clinical manifestations of colitis and histologic and transcriptomic changes reflecting mucosal inflammation. This efficient and reproducible model provides a valuable tool for investigating the connection between IBD and host metabolism.

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Protokół

All animal experiments were performed in compliance with the protocol approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Texas Southwestern Medical Center, in accordance with the “Guide for the Care and Use of Laboratory Animals" [Approval Number: 2017-102011]. Euthanasia was performed in accordance with institutional guidelines. No anesthesia was required for the procedures performed. Specific details for materials are described in the Table of Materials.

1. Establishing the piroxicam-accelerated enterocolitis model in IL-10-KO mice

  1. Maintain IL-10-KO mice in a specific pathogen-free (SPF) facility on a 12-h light cycle with ad libitum access to chow and water.
  2. Individually house 7–8-week-old, age and sex-matched mice in microisolator cages. Allow mice to acclimate to single housing and daily handling for at least one week prior to the start of the experiment.
    NOTE: Ensure that body weights are >20 g for males or >17 g for females, and that mice are free from fight wounds.
  3. Assign mice to an experimental group and a control group. For the experimental group, replace the standard chow with piroxicam-fortified chow. For the control group, provide fresh standard chow. Add 50 g chow to each cage hopper.
    NOTE: Allocate at least five mice per sex to each group. The piroxicam-fortified chow (200 ppm) was prepared by Teklad using piroxicam supplied by the investigators for the production of a custom laboratory animal diet. To minimize batch-to-batch variability, it is recommended that all animals within a given experiment receive chow from the same production batch. When possible, the same batch should also be used across experiments to improve reproducibility.

2. Monitoring of body weight and feeding behavior

  1. Using an analytical scale, record the body weight of each mouse. Weigh each mouse individually at the same time each day, daily for 7 consecutive days. Report daily body weight as a percentage of the baseline weight on day 0 (set as 100%).
    NOTE: A weight loss greater than 20% indicates excessive stress and risk of imminent death. Mice should be euthanized if this threshold is reached.
  2. Using an analytical scale, record the initial weight of the piroxicam-fortified chow and the standard chow in each cage.
  3. Then, measure the remaining chow in each cage hopper at the same time each day, daily for 7 consecutive days.
  4. Calculate daily chow consumption by subtracting the daily chow weight from the remaining chow from the prior day.
    NOTE: Routinely check the amount of chow and refill if it is below 10 g. The palatability of piroxicam chow does not influence intake and should closely resemble that of standard chow.

3. Monitoring of disease activity

  1. On days 0 and 7, visually inspect fecal pellets from individual mice and determine the presence of blood in stool.
  2. If no blood is visible, perform a fecal occult blood test by smearing a pellet onto the test card, then adding the supplied developer reagent. Score results according to Table 1.
  3. On days 0 and 7, visually inspect freshly voided fecal pellets to assess stool consistency. Use flat forceps to aid in determining consistency. Score results according to Table 1.
  4. On days 0 and 7, determine the degree of rectal prolapse by inspecting the perianal region. Score results according to Table 1.
  5. Measure body weight as described above. Score results according to Table 1.
    NOTE: Disease activity index (DAI) scoring should be performed in a blinded manner by the same researcher throughout the experiment to ensure consistency, minimize observer bias, and improve the reliability of the assessment.

4. Harvesting of colonic tissue

  1. Euthanize mice by CO2 asphyxiation and cervical dislocation as reported elsewhere20.
  2. Place the mouse in a supine position and spray 70% ethanol on the ventral abdomen.
  3. Lift the skin with forceps and use surgical scissors to cut along the midline. Expose the peritoneal cavity and locate the colon.
  4. Expose the colon and cecum using blunt dissection. Remove the colon en bloc, including the cecum and the anal cuff.
  5. Place the colon on a flat surface and remove any connective tissue.
  6. Measure and record colon length.
  7. After measurement of colon length, remove the cecum by cutting at the ceco-colonic junction.
  8. Prepare a 10 mL syringe filled with phosphate-buffered saline (PBS) with an attached 22-gauge ball tip reusable steel gavage needle. Thread the needle into the colon and flush out intestinal contents.
  9. Place the flushed colon in a Petri dish containing PBS and rinse to remove residual contents. Once cleared, use it for downstream assays.

5. Histology analysis

  1. Lay the colon flat on a glass slide. Use forceps to wrap the tissue around itself, starting from the distal end, to form a “Swiss roll”. In this fashion, the distal/anal end will remain in the inner roll with the more proximal regions extending to the outer roll.
  2. Using a 27-gauge needle, pin the rolled colon to maintain the roll and place it inside an embedding tissue cassette.
  3. To fix tissues, submerge tissue cassettes in 10% buffered formalin solution for 16 h at 4 °C.
    CAUTION: 10% formalin is harmful if in contact with skin and can cause severe skin burns and eye damage. Handle cautiously with protective gloves and scientific goggles. Residual formalin should be properly disposed of following institutional guidelines.
  4. After formalin fixation, process tissues for paraffin embedding and section them for mounting on glass slides.
    NOTE: Samples should be submitted to a histology laboratory with the necessary equipment for processing tissue cassettes in paraffin, scroll sectioning, slide mounting, and hematoxylin and eosin staining.
  5. Stain tissue slides with hematoxylin and eosin (HE), as per established protocols21.
  6. Using the histological scoring system described in Table 2, evaluate the following histologic features in each section: tissue damage from enterocolitis, lamina propria inflammatory cell infiltration, and percentage of area involved. Combine the scores in each section to generate a total score (Table 2).
    Total score = Features × Involvement (Tissue Damage) + Features × Involvement (Lamina Propria Inflammatory Cell Infilteration)  (1)
  7. Representative histopathological images of tissue damage and cell infiltration can be found in the publication by Erben et al22.
    NOTE: Histologic scoring should be performed in a blinded manner, preferably by a trained pathologist, to ensure consistency and reliability of the assessment.

6. Immunofluorescent staining of formalin-fixed paraffin-embedded tissue

  1. Place tissue slides in a slide rack and into a 55 °C slide dryer for 1 h to melt paraffin.
  2. Place slides in a staining rack and sequentially submerge the rack for 3 min into staining jars with xylene. Repeat this step on 3 occasions.
  3. Submerge the staining rack for 3 min in staining jars with 100% ethanol. Repeat this step on 3 occasions.
  4. Submerge the staining rack for 3 min in the staining jar with 95% ethanol.
  5. Submerge the staining rack for 3 min in the staining jar with 80% ethanol.
  6. Submerge the staining rack for 5 min in staining jars with deionized (DI) water.
    NOTE: All prior steps must be performed in a ventilated hood due to the xylene fumes. Handle cautiously with protective gloves and scientific goggles. Residual xylene should be properly disposed of in accordance with institutional guidelines.
  7. Transfer slides to a slide rack and submerge in staining jar with 1× citrate retrieval solution.
  8. Place the staining jar in the staining dish support.
  9. Place the staining dish support in the pressure cooker.
  10. Cook for 15 min in a pressure cooker.
  11. Recover the slides from the pressure cooker and allow them to cool down to room temperature.
  12. Incubate slides with 300 µL blocking buffer (3.5% goat serum diluted in PBS) for 1 h in a humidified chamber. Ensure the tissue is completely covered by the blocking buffer.
  13. Expose slides to 300 µL of primary antibody diluted in blocking buffer for 16 h at 4 °C, inside a humidified chamber. Ensure the tissue is completely covered by the primary antibody. The following primary antibody was used: Anti-S100A8/S100A9 (1:500).
    NOTE: Antibody dilutions will be reagent-specific and should follow the supplier's recommendations.
  14. Rinse slides by serially submerging them in PBS for 5 min on 3 occasions in a staining jar.
  15. Expose slides to 300 µL of a diluted fluorescent secondary antibody in blocking buffer for 1 h at room temperature, in a humidified chamber. Ensure the tissue is completely covered by the secondary antibody. The following fluorescent secondary antibody was used: goat anti-Rabbit Alexa Fluor 555 (1:150 dilution).
    NOTE: From this point on, slides should be protected from light to prevent photobleaching of fluorophores. Dilutions of secondary antibodies will be reagent-specific and should follow the supplier's recommendations.
  16. Rinse slides by serially submerging them in PBS for 5 min on 3 occasions in a staining jar.
  17. Expose slides to nuclear staining by submerging in Hoechst solution diluted 1:5000 in PBS for 20 min in a staining jar.
  18. Rinse slides by serially submerging them in PBS for 5 min on 3 occasions in a staining jar.
  19. Carefully wipe off any PBS from the slides using a non-abrasive tissue. Add 50 µL of antifade mounting medium and a coverslip.

7. RNA extraction

  1. Snap freeze the entire colon or a fragment in liquid nitrogen and then store at -80 °C. Alternatively, submerge in 1.5 mL of RNALater preserving solution and store according to the manufacturer’s instructions.
  2. Thaw previously frozen colon and place on a flat surface. Disrupt and homogenize the tissue with a handheld homogenizer.
  3. Isolate RNA using the kit, following the manufacturer’s instructions.
  4. Measure RNA concentration using a spectrophotometer. A260/A280 ratios > 1.8 and A260/A230 ratios of 2.0–2.2 indicate acceptable RNA purity.
  5. Proceed with reverse transcription, followed by qPCR with SYBR green intercalating dye.
  6. Analyze results using the quantification platform or a similar instrument.

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Wyniki

Samce i samice myszy IL-10-KO rozwijają enterokolit po krótkiej ekspozycji na dietę wzbogaconą piroksikamem (Rycina 1A–E). Do 2. dnia myszy eksponowane na piroksikam wykazywały statystycznie istotnie większy spadek masy ciała niż kontrolne myszy tej samej płci karmione standardową paszą, a porównywalny spadek masy ciała zaobserwowano u obu płci (Rycina 1B). Pozorne dzienne spożycie pokarmu pozostało niezmienione podczas ekspozycji na piroksikam ...

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Dyskusja

Inflammatory bowel disease is a complex polygenic disorder where preclinical models serve as invaluable tools to dissect pathways that contribute to IBD pathogenesis and develop novel diagnostic and therapeutic strategies. Currently, many IBD preclinical models rely on chemical exposure, such as dextran sulfate sodium (DSS), oxazolone, and trinitrobenzene sulfonic acid (TNBS), due to their ease of use. Genetic models that develop spontaneous colitis are also available. Among these, the IL-10-KO model is particularly valu...

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Oświadczenia

The authors declare no pertinent disclosures.

Podziękowania

We wish to thank the core facilities at UTSW that contributed to the work presented here. This work was supported by the following funding sources: NIH through K08DK127197 (LS-D), T32DK007745 (JW), and the Southwestern Foundation through Docstars award (LS-D).

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Materiały

Lista materiałów użytych w tym artykule
NazwaFirmaNumer katalogowyKomentarze
10% buffered formalinStatLab28600-11 Galllon
27 G needlesBD305109
Anti-S100A8 + S100A9 antibodyAbcamAB288715
BalanceFisher scientificS94792DFisher Science Education Portable Balances, 300 g
Citrate bufferSigma AldrichC9999-1000mL
DI waterFisher scientificSTLSL301
Dissecting forcepsFisher scientific22-327379
Ethanol, 100% 200 proofFisher scientificNC1675398Pharmco Products ETHYL ALCOHOL 200 PROOF
Ethanol, 190 proof, 95%Fisher scientificAC615110010
Ethanol, 80%Fisher scientificT08204K7
EZ-Quick Slide Staining DishIHC worldIW-2511Staining jar
EZ-Quick Slide Staining RackIHC worldIW-2512Slide rack
Feeding needleFisher scientificNC992498622 gauge, 25 mm
Fine scissorsFisher scientific14060-11
Flat forcepsFisher scientific21-125-109
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 555Thermo FisherAB_2535849
Handheld homogenizerFisher scientific15-340-167
HemoCueDanlee Medical Products, Inc.BCK 64151AHemoccult Dev/ Single Slide Test Cards - CLIA Waived
Hoechst 33342Invitrogen62249
IL-10 KO MiceThe Jason LaboratoryStrain #: 002251IL10-KO mice, genotype: B6.129P2-IL-10tm1Cgn/J
IVC mouse cagingAllentownMouse 500
Liquid nitrogenAirgasNI UHP300
Microscope cover glassFisher scientific12541033
NanodropThermo FisherND-ONE-W
Normal Goat serumVector labsS-1000-20
Phosphate buffered saline (PBS)Sigma AldrichD8537
Petri dishesFisher scientificFB0875713
PiroxicamSigma AldrichP0847supply to inotiv for preparation of custom animal diet
Piroxicam-fortified chowInotivCustom200 ppm
Primer: Mouse GAPDH forwardSigma AldrichN/A5' AGGTCGGTGTGAACGGATTTG 3' forward
Primer: Mouse GAPDH reverseSigma AldrichN/A5' TGTAGACCATGTAGTTGAGGTCA 3' reverse
Primer: Mouse IFN-G forwardSigma AldrichN/A5' ACTGGCAAAAGGATGGTGAC 3' forward
Primer: Mouse IFN-G reverseSigma AldrichN/A5' TGAGCTCATTGAATGCTTGG 3' reverse
Primer: Mouse IL-10 forwardSigma AldrichN/A5' CTTGCACTACCAAAGCCACA 3' (common)
Primer: Mouse IL-10 reverseSigma AldrichN/A5' GTTATTGTCTTCCCGGCTGT 3' (Wild type reverse)
Primer: Mouse IL-10 reverse (2)Sigma AldrichN/A5' CCACACGCGTCACCTTAATA 3' (Mutant reverse)
Primer: Mouse IL-1B forwardSigma AldrichN/A5' GCTGAAAGCTCTCCACCTCA 3' forward
Primer: Mouse IL-1B reverseSigma AldrichN/A5' AGGCCACAGGTATTTTGTCG 3' reverse
Primer: Mouse IL-6 forwardSigma AldrichN/A5' GTTCTCTGGGAAATCGTGGA 3' forward
Primer: Mouse IL-6 reverseSigma AldrichN/A5' TTTCTGCAAGTGCATCATCG 3' reverse
Primer: Mouse TNF forwardSigma AldrichN/A5' GCAGGTTCTGTCCCTTTCAC 3' forward
Primer: Mouse TNF reverseSigma AldrichN/A5' AGTGCCTCTTCTGCCAGTTC 3' reverse
QuantStudio 7 ProThermo FisherA43183
RNAlater solutionInvitrogenAM7020RNA Stabilization Solution, 100 mL
Rneasy mini kitQiagen74104
SHURDry SD-II Slide DryerGeneral dataSD-ll-120
Simport Scientific EasyDip Slide Staining RackFisher scientific22-038-494Staining rack
SlowFade Gold antifade reagentInvitrogenS36936
Staining dish supportBioSBBSB7086
Staintray IHC slide staining systemIHC worldM918-1Humidified chamber for IHC
SuperScript VILOInvitrogen11755050
SYBR Green Master mixApplied BiosystemsA46109
Tintoretriever pressure cookerBioSBBSB7008
Tissue cassettesFisher scientific 50-197-8152Research Products International Corp Tissue Processing Cassette, Pink, 500 per Case
XylenePharmco3990000001 Gallon

Bibliografia

  1. Hracs L, Windsor JW, Gorospe J, et al. Global evolution of inflammatory bowel disease across epidemiologic stages. Nature. 2025;642(8067):458-466.
  2. Dahlhamer JM, Zammitti EP, Ward BW, Wheaton AG, Croft JB. Prevalence of Inflammatory Bowel Disease Among Adults Aged ≥18 Years - United States, 2015. MMWR Morb Mortal Wkly Rep. 2016;65(42):1166-1169.
  3. Ng SC, Shi HY, Hamidi N, et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies. Lancet. 2017;390(10114):2769-2778.
  4. Caron B, Honap S, Peyrin-Biroulet L. Epidemiology of Inflammatory Bowel Disease across the Ages in the Era of Advanced Therapies. J Crohns Colitis. 2024;18(Supplement_2):ii3-ii15.
  5. Ye Y, Manne S, Treem WR, Bennett D. Prevalence of Inflammatory Bowel Disease in Pediatric and Adult Populations: Recent Estimates From Large National Databases in the United States, 2007-2016. Inflamm Bowel Dis. 2020;26(4):619-625.
  6. Rubtsov YP, Rasmussen JP, Chi EY, et al. Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity. 2008;28(4):546-558.
  7. Shouval DS, Biswas A, Goettel JA, et al. Interleukin-10 receptor signaling in innate immune cells regulates mucosal immune tolerance and anti-inflammatory macrophage function. Immunity. 2014;40(5):706-719.
  8. Glocker EO, Kotlarz D, Boztug K, et al. Inflammatory bowel disease and mutations affecting the interleukin-10 receptor. N Engl J Med. 2009;361(21):2033-2045.
  9. Sazonovs A, Stevens CR, Venkataraman GR, et al. Large-scale sequencing identifies multiple genes and rare variants associated with Crohn’s disease susceptibility. Nat Genet. 2022;54(9):1275-1283.
  10. Griffin H, Ceron-Gutierrez L, Gharahdaghi N, et al. Neutralizing Autoantibodies against Interleukin-10 in Inflammatory Bowel Disease. N Engl J Med. 2024;391(5):434-441.
  11. Kühn R, Löhler J, Rennick D, Rajewsky K, Müller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75(2):263-274.
  12. Berg DJ, Davidson N, Kühn R, et al. Enterocolitis and colon cancer in interleukin-10-deficient mice are associated with aberrant cytokine production and CD4(+) TH1-like responses. J Clin Invest. 1996;98(4):1010-1020.
  13. Mizoguchi A. Animal models of inflammatory bowel disease. Prog Mol Biol Transl Sci. 2012;105:263-320.
  14. Hart ML, Ericsson AC, Franklin CL. Differing Complex Microbiota Alter Disease Severity of the IL-10-/- Mouse Model of Inflammatory Bowel Disease. Front Microbiol. 2017;8:792.
  15. Keubler LM, Buettner M, Häger C, Bleich A. A Multihit Model: Colitis Lessons from the Interleukin-10-deficient Mouse. Inflamm Bowel Dis. 2015;21(8):1967-1975.
  16. Büchler G, Wos-Oxley ML, Smoczek A, et al. Strain-specific colitis susceptibility in IL10-deficient mice depends on complex gut microbiota-host interactions. Inflamm Bowel Dis. 2012;18(5):943-954.
  17. Berg DJ, Zhang J, Weinstock JV, et al. Rapid development of colitis in NSAID-treated IL-10-deficient mice. Gastroenterology. 2002;123(5):1527-1542.
  18. Hale LP, Gottfried MR, Swidsinski A. Piroxicam treatment of IL-10-deficient mice enhances colonic epithelial apoptosis and mucosal exposure to intestinal bacteria. Inflamm Bowel Dis. 2005;11(12):1060-1069.
  19. Holgersen K, Kvist PH, Markholst H, Hansen AK, Holm TL. Characterization of enterocolitis in the piroxicam-accelerated interleukin-10 knock-out mouse--a model mimicking inflammatory bowel disease. J Crohns Colitis. 2014;8(2):147-160.
  20. B C, K B, V B, et al. Recommendations for euthanasia of experimental animals: Part 2. DGXT of the European Commission. Laboratory animals. 1997;31(1).
  21. Ellis JL, Yin C. Histological Analyses of Acute Alcoholic Liver Injury in Zebrafish. J Vis Exp. 2017;(123):55630.
  22. Erben U, Loddenkemper C, Doerfel K, et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Pathol. 2014;7(8):4557-4576.
  23. Holgersen K, Kutlu B, Fox B, et al. High-resolution gene expression profiling using RNA sequencing in patients with inflammatory bowel disease and in mouse models of colitis. J Crohns Colitis. 2015;9(6):492-506.
  24. Ananthakrishnan AN, Adler J, Chachu KA, et al. AGA Clinical Practice Guideline on the Role of Biomarkers for the Management of Crohn’s Disease. Gastroenterology. 2023;165(6):1367-1399.
  25. Singh S, Ananthakrishnan AN, Nguyen NH, et al. AGA Clinical Practice Guideline on the Role of Biomarkers for the Management of Ulcerative Colitis. Gastroenterology. 2023;164(3):344-372.
  26. Sifuentes-Dominguez LF, Li H, Llano E, et al. SCGN deficiency results in colitis susceptibility. eLife. 2019;8:e49910.
  27. Sellon RK, Tonkonogy S, Schultz M, et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 1998;66(11):5224-5231.
  28. Bábíčková J, Tóthová Ľ, Lengyelová E, et al. Sex Differences in Experimentally Induced Colitis in Mice: a Role for Estrogens. Inflammation. 2015;38(5):1996-2006.
  29. Wagnerova A, Babickova J, Liptak R, Vlkova B, Celec P, Gardlik R. Sex Differences in the Effect of Resveratrol on DSS-Induced Colitis in Mice. Gastroenterol Res Pract. 2017;2017:8051870.
  30. Maite CB, Roy M, Emilie V. The Effect of Sex-Specific Differences on IL-10-/- Mouse Colitis Phenotype and Microbiota. Int J Mol Sci. 2023;24(12):10364.
  31. Dokoshi T, Seidman JS, Cavagnero KJ, et al. Skin inflammation activates intestinal stromal fibroblasts and promotes colitis. J Clin Invest. 2021;131(21):e147614.
  32. Dokoshi T, Chen Y, Cavagnero KJ, et al. Dermal injury drives a skin-to-gut axis that disrupts the intestinal microbiome and intestinal immune homeostasis in mice. Nat Commun. 2024;15(1):3009.
  33. Allard C, Zizzari P, Quarta C, Cota D. Food intake and body weight in rodent studies: the devil is in the details. Nat Metab. 2022;4(11):1424-1426.
  34. M W, R L, S S, et al. Combination therapy using intestinal organoids and their extracellular vesicles for inflammatory bowel disease complicated with osteoporosis. Journal of Orthopedic Translation. 2025;53.
  35. Y G, H Z, Y Y, et al. Injectable body temperature-responsive hydrogel for encephalitis treatment via sustained release of nano-anti-inflammatory agents. Biomaterials translational. 2024;5(3).

Dostęp ograniczony. Zaloguj się lub rozpocznij wersję próbną, aby wyświetlić tę treść.

Przedruki i uprawnienia

Tagi

Enterokolitis wywo any piroksykamemnieswoiste zapalenie jelitdysregulacja metabolicznamodel mysizapalenie jelita grubego indukowane NLPZzapalenie b ony luzowejutrata masy cia apomiar spo ycia pokarmuwydatek energetyczny

Ten artykuł został opublikowany

Film wkrótce dostępny