$$\rightleftharpoonup{xx}$$
$$\longleftharp{xx}$$,
$$\longrightharp{xx}$$,
All procedures involving animals have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. Genomic DNA Isolation from Stool
NOTE: Utilize a commercial kit to isolate microbial DNA from stool following a stool pathogen detection protocol. Remove samples directly from the -80 ˚C freezer and store on dry ice while weighing.
- Transfer up to 220 mg of stool to a clean microfuge tube containing 1.4 mL of room temperature (RT) stool lysis buffer (see Table of Materials).
- Vortex sample for 1 min to thoroughly homogenize solids (Figure 1B). Heat the suspension to 95 ˚C for 5 min to lyse all bacteria (including Gram-positive bacteria).
- Vortex samples for 15 s and then centrifuge at 20,000 x g for 1 min to pellet the stool solids. Transfer supernatant to a 2 mL microfuge tube. Add one tablet to each sample to absorb PCR inhibitors, vortex until the tablet is dissolved, and incubate the sample at RT for 1 min.
- Centrifuge the sample at 20,000 x g for 3 min and transfer the supernatant to a new microfuge tube. Centrifuge at 20,000 x g for 3 min. Aliquot 15 μL of proteinase K (20 mg/mL stock) into a new 1.5 mL microfuge tube. Pipette 200 μL of the sample into the tube containing proteinase K.
- Add 200 μL of guanidinium chloride lysis buffer to the tube, vortex thoroughly for 15 s (see Table of Materials) and incubate the sample at 70 ˚C for 10 min. Add 200 μL of ethanol (96-100%) to the tubes and mix well by vortexing.
- Place a silica-based spin column in a 2 mL collection tube and apply the samples to the column. Close the lid and centrifuge for 1 min at 20,000 x g.
- Transfer the column to a new 2 mL collection tube and add 500 μL of wash buffer 1 to the column, cap the column and centrifuge for 1 min at 20,000 x g. Transfer the column to a new 2 mL collection tube and add 500 μL of wash buffer 2 to the column, close the cap, and centrifuge at 20,000 x g for 3 min.
- With the cap closed, transfer the column to a new 2 mL collection tube, and centrifuge for an additional 1 min at 20,000 x g to remove the residual wash buffer. Transfer the column to a 1.5 mL labeled microfuge tube and elute the sample by adding 200 μL of elution buffer containing EDTA to the membrane (see Table of Materials).
- Close the cap and incubate at RT for 1 min. Centrifuge the sample for 1 min at 20,000 x g. Discard the column.
2. DNA Concentration Determination and Sample Preparation for PCR
NOTE: Utilize a fluorometer and a commercially available dsDNA fluorescent assay to determine genomic DNA concentration in each sample (see Table of Materials). The fluorescent dye must bind double-stranded DNA specifically.
- Prepare a 1:200 dilution of each sample (1 µL of each sample in 199 µL dsDNA master mix) and a 1:50 dilution of standards. Analyze on a fluorometer using the dsDNA setting.
Note: A high volume of DNA in PCR can be inhibitory, therefore, the volume of DNA used must not be more than 10% of the final volume of the PCR. A fluorometer enables accurate measurement of DNA in the sample, as only DNA bound to the fluorescent dye will fluoresce, eliminating the possible contribution of contaminants to the final calculated DNA concentration. This level of accurate quantitation is essential for the downstream sequencing application.
- Prepare PCR templates diluted to 5 ng/μL with the appropriate volume of 10 mM Tris, pH 8.5 to make working template stocks of each sample.
- Store samples at -20 °C.
3. Design Primers to the 16S Desired V Regions
- Design primers to selectively amplify the desired V 16S rRNA regions.
- Analyze primers with Probe Match, from the Ribosomal Database Project, to determine the approximate hit rate for various phyla.
Note: For V1-V3 regions, the current study used published primers Bosshard forward, which bind at position 8 within the V1 region, and 533 reverse, which binds at position 533 within the V3 region. Primers must include overhang adapter sequences for indexing.
- When designing primers, include adapter sequences at the 5' ends of each primer, as recommended for 16S metagenomics sequencing library preparation (Table 1).
- Synthesize these large primers with cartridge purification. Reconstitute desiccated primers and dilute a PCR working stock to 1 μM in 10 mM Tris, pH 8.5.
4. Amplicon PCR to Amplify the V Region(s) with Overhang Adapter Sequences Attached
- Set up the amplicon PCR reaction mix as described in Table 2.
- Place an adhesive clear PCR plate seal on the plate and run the amplicon PCR using the parameters in Table 3.
- (Optional) Run amplicon PCR products on an agarose gel or a high sensitivity DNA assay that enables quantitative measurement of amplicon size (see Table of Materials).
Note: The amplicon size from this study is 550 bp (Figure 2a).
5. PCR Cleanup Using Magnetic Beads
- Centrifuge the amplicon PCR plate quickly at 1,000 x g for 1 min to collect condensation.
Note: PCR tube strips can be used instead of PCR plates to minimize contamination. Discard tube lids and never reuse them.
- Vortex the magnetic beads to evenly disperse them and add 20 μL of magnetic beads to each amplicon PCR well, then pipette the entire volume up and down slowly 10 times.
- Incubate at RT for 5 min. Place the PCR plate on a magnetic stand for 2 min until magnetic beads are collected and the supernatant is clear. Remove and discard the supernatant.
- Wash beads with 200 μL fresh 80% ethanol while the PCR plate is on the magnetic stand and incubate for 30 s at RT on the magnetic stand. Carefully remove the supernatant.
- Repeat the wash for a second time. Now, use a fine pipette tip to remove any residual ethanol from the wells and allow air drying for 10 min.
- Remove the PCR plate from the magnetic stand and add 52.5 μL of 10 mM Tris pH 8.5 to each well. Pipette up and down 10 times to suspend beads and incubate at room temperature for 2 min.
- Transfer the PCR plate to the magnetic stand to collect magnetic beads and transfer 50 μL of the supernatant to a clean PCR plate. Place an adhesive clear PCR plate seal on the plate and store at -20 ˚C for up to one week.
| Amplicon PCR Primers |
| Forward | 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3' |
| Reverse | 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3' |
| Locus specific sequences are shown in bold and the non-bold is the overhang adapter sequence. |
Table 1: Amplicon PCR Primers.
| Amplicon PCR reaction set up | |
| Volume |
| Microbial DNA (5ng/μl) | 2.5 μl |
| Forward Primer (1 μM; from step 3.1) | 5.0 μl |
| Reverse Primer (1 μM; from step 3.1) | 5.0 μl |
| 2X HotStart Ready Mix | 12.5 μl |
| Total | 25.0 μl |
Table 2: Amplicon PCR Primers.
| Amplicon PCR set up |
| 95 °C for 3 minutes | |
| 25 Cycles of: | |
| 95 °C for 30 seconds |
| 55 °C for 30 seconds |
| 72 °C for 60 seconds |
| 72 °C for 3 minutes | |
| Hold at 4 °C | |
Table 3: Amplicon PCR Program Set Up.