Detection of a Target Analyte Using a Bacterial Biosensor

Abstract

Source: Barber, A. E., et al. Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue. J. Vis. Exp. (2019).

This video demonstrates the detection of specific analytes using a bacterial biosensor. A bacterial culture carrying a plasmid with a red fluorescent protein (RFP) gene under an analyte-sensitive promoter is taken. After thoroughly wiping the test surface, a small section of the wipe is immersed in the culture and incubated. The analyte interaction with the promoter activates RFP expression, confirming the presence of the target analyte.

Protocol

NOTE: Synthesis of E. coli expressing red fluorescent protein (RFP) is presented.

1. Preparation of plasmid deoxyribonucleic acid (DNA) from E. coli

1. Thaw E.coli containing a plasmid with an RFP gene and an ampicillin resistance gene, and grow the E.coli on Luria Broth (LB) agar plates containing 100 µg/mL ampicillin at 37 °C for 24 h. For example, use the J10060 plasmid from the registry of standard biological parts used for synthetic biology (see Table of Materials). The J10060 plasmid includes a gene for RFP under the control of a pBad promoter region and an ampicillin resistance gene. Alternatively, transform E.coli (refer to step 3.2) with the plasmid prior to growth on the LB agar plates.
2. Follow a standard miniprep protocol (see Table of Materials) to isolate DNA from 1 mL of an E. coli culture that contains the J10060 plasmid. The purpose of the following protocol is to remove the pBad promoter and replace it with the desired promoter for the device.
3. Following the plasmid miniprep, store the DNA in the freezer until ready for digestion.

2. Restriction enzyme digestion

1. Set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 μL of J10060 plasmid DNA (isolated in step 1), 8 μL of water, and 1 μL each of EcoRI and NheI enzymes pre-mixed with 1 μL of buffer (see Table of Materials).
2. For the promoter DNA, set up the following reaction in a microcentrifuge tube for EcoRI and NheI digestion: 10 μL of annealed promoter DNA sequences (8 μL of water, and 1 μL each of EcoRI and NheI enzymes pre-mixed with 1 μL of buffer.
   1. For Antimony (Sb-), Lead (Pb-), or Trinitrotoluene (TNT)-RFP (see Table of Materials), dissolve the oligonucleotides in buffer (30 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5; 100 mM potassium acetate), incubate in equal molar concentrations, heat to 94 °C for 2 min, and gradually cool at room temperature).
3. Mix the samples by pipetting gently up and down with the pipette set to 10 μL.
4. Incubate for 30 min at 37 °C.
5. Heat-inactivate the enzymes at 80 °C for 5 min.
6. Store the digested DNA in the freezer until ready for the next step.

3. Ligation and transformation

1. Ligation
   1. Using the plasmid and promoter DNA that were double-digested with EcoRI and NheI in step 2, set up the reaction mixture shown in Table 1 in a microcentrifuge tube on ice; add the T4 DNA Ligase last.NOTE: Table 1 shows a ligation using a molar ratio of 1:3 vector to insert for the indicated DNA sizes.
   2. Gently mix the reaction by pipetting up and down and microcentrifuge briefly.
   3. Incubate at room temperature for 10 min.
   4. Heat-inactivate at 65 °C for 10 min.
2. Transformation
   1. Thaw a tube with 20 µL of DH5-alpha Competent E. coli cells on ice until the last ice crystals disappear.
   2. Add 5 µL of plasmid DNA to the cell mixture. Carefully flick the tube 4-5 times to mix the cells and DNA.
   3. Place the mixture on ice for 2 min.
   4. Heat shock at exactly 42 °C for exactly 30 s. Do not mix.
   5. Place on ice for 2 min. Do not mix.
   6. Pipette 380 µL of room temperature super optimal broth with catabolite repression (SOC) into the mixture. Immediately spread onto an LB agar plate containing ampicillin (100 µg/mL) and incubate overnight at 37 °C.
   7. Check the plates within 24 h for growth.
   8. Seal the plates with sealing film and store them in the refrigerator until ready for the next step.

4. Colony polymerase chain reaction (PCR)

1. Add to a PCR tube (set up 4 reaction tubes) the reaction mixtures shown in Table 2.
2. Gently mix the reactions by pipetting up and down.
3. Using a yellow pipette tip, scrape a colony (or very small region) of the transformed E. coli. Transfer a swipe of this E. coli onto a new LB/ampicillin/agar plate that has been sectioned off, and then insert the pipette tip into the PCR tube. Shake the pipette tip to mix the E. coli with the PCR mix. Repeat three more times for additional colonies. Transfer the PCR tubes to a PCR machine and begin thermocycling using the program shown in Table 3.
4. Run gel electrophoresis using a 2% agarose gel in TAE 9Tris-Acetate-EDTA) to determine which colonies have the best ligation into the plasmid, and grow those colonies on a new plate.
5. Store the plates in the refrigerator until ready for testing. Prepare a liquid culture in Luria broth with 100 µg/mL ampicillin added for chemical testing.

5. DNA Sequencing

1. For each sample, add 5 µL of plasmid, 4 µL of the sequencing primer, and 3 µL of deionized water.
2. Place this mixture into a tube and send it for DNA sequencing (see Table of Materials).
3. Analyze DNA sequence data to compare the expected and observed DNA sequences using DNA sequence analysis software to ensure that there is no mutation and that the genes were correctly inserted.
   NOTE: Using E. coli as a chemical sensor is presented below.

6. Preparation of E. coli cultures

1. Prepare LB with 100 µg/mL ampicillin for liquid cultures.
2. Prepare liquid cultures of the sensor bacteria, the positive control* bacteria, and the negative control** bacteria.
   NOTE: *Positive control bacteria: E. coli containing a plasmid with the RFP gene under control of a constitutive promoter; plasmid E1010 from the registry of standard biological parts used for synthetic biology (see Table of Materials) was used in this work.**Negative control bacteria: E. coli containing a plasmid with the RFP gene under control of a different promoter, such as the pBad promoter (plasmid J10060 from the registry of standard biological parts used for synthetic biology (see Table of Materials) or a plasmid that does not have the RFP gene.
3. Place the cultures into a shaking incubator at 37 °C and 220 rpm for a minimum of 8 h, maximum of 18 h. Cloudy broth indicates bacterial growth.

7. Titrating E. coli to check the function of the device

NOTE: Once the sensors have been titrated to check function, this step does not need to be repeated. A positive control in the form of the addition of lead, antimony, and 2,4-DNT or 1,3-dinitrobenzene (1,3-DNB) can check the function of the devices for each use without the need for the full titration.

1. Prepare a stock solution of the analyte(s) of interest at a concentration of 10 ppm in water. If solubility is an issue, use a 50/50 water/methanol mixture.
2. Using Table 4 as a guide, label the appropriate number of sterile culture tubes and place 2 mL of the cultured broth (from protocol step 6) into each tube.
   NOTE: In order to determine a general analytical range, do at least three different levels of an analyte with the sensor bacteria, one level with the negative control, and one level with the positive control. There should also be one tube of each of the bacteria that has no added metal (another type of negative control). To more accurately determine analytical range and limits of detection, use a larger range of analyte concentrations.
3. Add analyte stock solution to the tubes containing 2 mL of broth as noted in Table 4, place the snap caps on the culture tube so that they are loose (to allow air flow into the tube), and vortex the culture tube.
4. Leave the snap caps loosely on the culture tubes, and place them into a shaking incubator at 220 rpm and 37 °C for at least 24 h.
5. Remove the tubes from the incubator, snap the caps onto the tubes tightly, and store the tubes in the refrigerator until ready for fluorescence analysis.

8. Using E. coli as a chemical sensor for gunshot residue (GSR)

1. Using an ethanol-based wipe designed for removing lead (see Table of Materials), wipe all surfaces of the hands, including between the fingers. Use a separate wipe for each hand. Store the wipes in an appropriately labelled sealable bag until analysis.
2. For surfaces to be tested, use an alcohol-based wipe for large surfaces or a cotton swab moistened with ethanol for small surfaces.
   NOTE: To demonstrate the sensors’ response to GSR, the inside of a spent .40 caliber cartridge casing was swabbed with an ethanol-moistened cotton swab.
3. Wearing clean gloves and using scissors that have been cleaned with alcohol, cut an approximately 1 cm² section out of the center of the wipe.
4. Place the cut piece of the hand wipe or the cotton swab directly into a culture tube that contains 2 mL of the sensor bacteria, ensuring that it is submerged in the broth.
5. Proceed as described above in steps 7.4 – 7.5.

Table 1. Reaction mixture for ligation, protocol step 3.1.1.

COMPONENT	20 μL REACTION
10X T4 DNA Ligase Buffer	2 μL
Plasmid DNA (3 kb)	3 μL
Promoter DNA (0.7kb)	10 μL
Nuclease-free water	4 μL
T4 DNA Ligase	1 μL

Table 2. Reaction mixtures for colony PCR, protocol step 4.1.

Component	25 μL reaction
10 µM Forward Primer	0.5 µL
10 µM Reverse Primer	0.5 µL
OneTaq 2X Master Mix	12.5 µL
Nuclease-free water	11 µL

Table 3. PCR thermocycling parameters for protocol step 4.3.

STEP	TEMP	TIME
Initial Denaturation	94 °C	30 s
30 Cycles	94 °C	30 s
	55 °C	45 s
	68 °C	60 s
Final Extension	68 °C	5 min
Hold	4 °C

Table 4. General experiment set up for titration of biosensors, protocol step 7.2.

Tube ID	Bacteria	Concentration of analyte solution added (ppm)	Metal added	Volume of analyte solution added to 2,000 µL broth	[analyte], ppb
1	PbRFP	10	Pb	2.5	12
2	PbRFP	10	Pb	75	361
3	PbRFP	10	Pb	150	698
4	PbRFP	0	none	0	0
5	RFP neg	10	Pb	10	50
6	RFP pos	10	Pb	10	50

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1,3-dinitrobenzene, 97%	Aldrich	D194255-25G
2,4-dinitrotoluene, 97%	Aldrich	101397-5G
Agar	Fisher Scientific	BP1423-500
Ampicillin	Fisher Scientific	BP1760-5
Antimony, Reference Standard Solution (1000ppm ±1%/Certified)	Fisher Scientific	SA450-100	Standard in dilute HNO₃
Cut Smart Buffer	New England BioLabs	B7204S
Duplex Buffer	Integrated DNA Technologies	11-01-03-00
EcoRI-HF Restriction Enzyme	New England BioLabs	R3101S
Ethanol, HPLC grade, denatured	Acros Organics	AC611050040	Solvents do not need to be HPLC grade, ACS or reagent grade will work.
Eurofins Genomics SimpleSeq DNA Sequencing Kits	Eurofins Genomics	SimpleSeq Kit Standard
Forward primer for colony PCR	Integrated DNA Technologies		5’- GCCGCTTGAATTCGTCATATAT-3’
Forward primer for DNA sequencing	Integrated DNA Technologies		5’- GTAAAACGACGGCCAGTG-3’
IBI Science High Speed Plasmid Mini-kit	IBI Scientific	IB47101
LB Broth, Miller	Fisher Scientific	BP1426-500
Lead, Reference Standard Solution (1000ppm ±1%/Certified)	Fisher Scientific	SL21-100	Standard in dilute HNO3
LeadOff Disposable Cleaning and Decon Wipes	Hygenall	45NRCN	Sold in canisters or individually wrapped, any alcohol based wipe will work.
Methanol, HPLC grade	Fisher Scientific	A452-4	Solvents do not need to be HPLC grade, ACS or reagent grade will work.
NEB 5-alpha Competent E. coli cells	New England BioLabs	C2987I
NheI-HF Restriction Enzyme	New England BioLabs	R3131S
Nuclease free water	New England BioLabs	B1500S
OneTaq 2X Master Mix with Standard Buffer	New England BioLabs	M0482S
Plasmids from the registry of standard biological parts used for synthetic biology	Registry of Standard Biological Parts		http://parts.igem.org/Main_Page
Promoter Sequences	Integrated DNA Technologies		Sb promoter: 5’-GCATGAATTCAGTCATATATGTTTTTGACTTATCCGCTTCGAAGAGAGAGACACTACCTGCAACAATCGCTAGCGCAT-3’ 3’-CGTACTTAAGCTCACTATATACAAAAACTGAATAGGCGAAGCTTCTCTCTCTGTGATGGACGTTGTTAGCGATCGCGTA-5’Pb promoter: 5’-GCATGAATTCGTCTTGACTCTATAGTAACTAAGGGTGTATAATCGGCAACGCGAGCTAGCGCAT-3’ 3’-CGTACTTAAGCAGAACTGAGATATCATTGATCTCCCACATCTTAGCCGTTGCGCTGCGATCGCGTA-5’TNT promoter: 5’GCATTCTAGATCAATTTATTTGAACAAGGCGGTCAATTCTCTTCGATTTTATCTCTCGTAAAAAAACGTGATACTCATCACATCGACGAAACAACGTCACTTATACAAAAATCACCTGCGAGAGATTAATTGAATTCGCAT3’ 3’CGTAAGATCTAGTTAAATAAACTTGTTCCGCCAGTTAAGAGAAGCTAAAATAGAGAGCATTTTTTTGCACTATGAGTAGTGTAGCTGCTTTGTTGCAGTGAATATGTTTTTAGTGGACGCTCTCTAATTAACTTAAGCGTA5’
Reverse primer for colony PCR	Integrated DNA Technologies		5’- GCCGCTTGAATTCGTCTAGACT- 3’
Reverse primer for DNA sequencing	Integrated DNA Technologies		5’- GGAAACAGCTATGACCATG-3’
T4 DNA Ligase	New England BioLabs	M0202S