Detection of Target Gene Expression in a Bacteria-Infected Mouse Brain

Abstract

Source: Zhang, S., et al. Intracranial Subarachnoidal Route of Infection for Investigating Roles of Streptococcus suis Biofilms in Meningitis in a Mouse Infection Model. J. Vis. Exp. (2018).

This video demonstrates the detection of target gene expression in a bacteria-infected mouse brain. RNA is extracted, treated with a DNA-degrading enzyme, and reverse-transcribed into cDNA. The cDNA is amplified through thermal cycling with gene-specific primers, while a DNA-binding dye binds to the amplified DNA, emitting fluorescence. The fluorescence signals are analyzed to confirm the presence of the target gene.

Protocol

1. Preparation of Bacteria

Note: Streptococcus suis (S. suis) serotype 2 virulent strain P1/7 was isolated from a diseased pig with meningitis. Strain P1/7 was grown in Todd-Hewitt broth (THB, formula per liter of THB: Heart Infusion, 3.1 g; neopeptone, 20.0 g; dextrose, 2.0 g; sodium chloride, 2.0 g; disodium phosphate, 0.4 g; sodium carbonate, 2.5 g) and plated on Todd-Hewitt agar (THA, formula per liter of THA: Heart Infusion, 3.1 g; neopeptone, 20.0 g; dextrose, 2.0 g; sodium chloride, 2.0 g; disodium phosphate, 0.4 g; sodium carbonate, 2.5 g; agar, 15.0 g) at 37 °C and 5% CO₂.

1. Collection of strain P1/7 planktonic cells
   1. Collect 5 mL of planktonic cells from mid-log phase culture (OD₆₀₀=0.6), centrifuge for 3 min at 8000 × g, and then wash 3 times with phosphate-buffered saline (PBS).
   2. Resuspend the cells with 5 mL of 25% glycerol in THB, aliquot into 5 tubes, and then store at -80 °C.
2. Collection of strain P1/7 biofilm state cells
   1. Take 20 mL of an overnight culture and add to 180 mL of fresh THB; divide the diluted culture equally into 10 round culture plates, and then put the plates in an incubator at 37 °C in 5% CO₂ for 24 h.
   2. After incubation, shake the plate gently to resuspend the bacteria that have not adhered to the plate, and then discard the supernatant by aspiration.
      NOTE: Shake the plate gently and avoid resuspending the sediment.
   3. Add 5 mL of PBS to harvest biofilm state cells, resuspend the sediment completely, and then transfer the sample to a new tube.
   4. Sonicate the biofilm state cells from the last step with the following parameters: 60 W, 4 cycles, 5 s on and 10 s off.
   5. Centrifuge for 3 min at 8000 × g and store the supernatant at -80 °C.
      NOTE: The supernatant may contain biofilm components, and it can be used to resuspend the biofilm bacteria before infection as described in the animal experiments (Step 2).
   6. Resuspend the sediment with 10 mL 25% glycerol in THB and then store the biofilm state cells at -80 °C.

2. Animal Experiments

1. Use SPF 6-week-old female BALB/c mice in this study. Infect all mice through the intracranial subarachnoidal route of infection, whose injection site is located 3.5 mm rostral from the bregma.
   1. For histopathological analysis, infect two groups of mice (5 mice per group) using planktonic cells or biofilm state cells at a dose of 3 × 10⁷ colony-forming units (CFU), and another 5 mice were injected with PBS as a control.
   2. For the detection of mRNA expression of TLR2 and cytokines in the brain, infect two additional groups of mice (6 mice per group) using planktonic cells or biofilm state cells at a dose of 3 × 10⁷ CFU.
   3. Determine the number of viable bacteria by plating serial dilutions onto THA.
   4. Euthanize all mice at 12 h post-infection for further research.​
      NOTE: Glycerol in the stock medium must be removed before infection. Both planktonic cells and biofilm state cells recovered from -80 °C are washed 3 times with PBS. Then, planktonic cells are resuspended with PBS and diluted to the appropriate dose for infection; biofilm state cells are resuspended with the stored supernatant (from step 1.2.5) and diluted to the appropriate dose for infection. The volume for infection should not be more than 50 µL.
2. Detecting the mRNA expression of TLR2 and cytokines in brain tissue
   1. Extract the total RNA from brain tissue using an RNA extraction kit.
      1. For each mouse, use the whole brain tissue for extracting RNA. Divide the whole brain tissue into 5 tubes. Take up to 100 mg of brain tissue and add 1 mL of lysis solution to each tube containing the lysing matrix provided by the kit.
      2. Process the tube in a homogenizer for 40 s at a setting of 6.0, and then centrifuge the tube at 12000 × g and 4 °C for 5 min.
      3. After centrifugation, transfer the upper phase to a new microcentrifuge tube.
      4. Incubate the transferred sample for 5 min at room temperature; add 300 µL of chloroform, vortex for 10 s, and then incubate for 5 min at room temperature.
      5. Centrifuge the tube at 12000 × g and 4 °C for 5 min. Transfer the upper phase to a new tube.
      6. Add 500 µL of cold absolute ethanol to the tube before inverting it 5 times, and then store the sample at -20 °C for at least 1 h.
      7. Centrifuge the tube at 12000 × g and 4 °C for 15 min and remove the supernatant. Wash the pellet with 500 µL of cold 75% ethanol in RNase-free water (H₂O).
      8. Remove the ethanol, air-dry the pellet for 5 min at room temperature, and resuspend the RNA in 100 µL of RNase-free H₂O.
      9. Incubate the RNA for 5 min at room temperature and determine the RNA concentration using an RNA bioanalyzer.
   2. Perform complementary DNA (cDNA) synthesis, including elimination of genomic DNA (gDNA), using a thermocycler with a reverse transcription (RT) reagent kit.
      1. Add 1 µg of RNA to a tube containing 2 µL of 5x gDNA elimination buffer, 1 µL of gDNA elimination enzyme, and RNase-free H₂O until the volume reaches 10 µL. Incubate for 2 min at 42 °C.
      2. Add 10 µL of master mix (1 µL of RT enzyme Mix I, 1 µL of RT Primer Mix, 4 µL of 5x Buffer 2, and 4 µL of RNase-free H₂O) to the reaction solution from the last step and then mix gently. Proceed immediately with the RT reaction: 37 °C for 15 min and then 85 °C for 5 s.
      3. Perform the quantitative real-time polymerase chain reaction (RT-qPCR) analysis using a Real-Time PCR machine with a SYBR RT-qPCR kit. Add 10 µL of 2x enzyme, 0.8 µL of forward primer, 0.8 µL of reverse primer, 0.4 µL of 50x ROX Reference Dye II, 2 µL of cDNA template, and RNase-free H₂O until a total volume of 20 µL.
      4. Run each sample in triplicate using the following thermal parameters: 30 s at 94 °C, followed by 40 cycles of 5 s at 95 °C, and 34 s at 60 °C, with a final stage of 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C. Primers for RT-qPCR are listed in Table 1. Housekeeping genes B2m and 18s rRNA were used as the internal controls.
   3. Calculate the relative fold change based on the 2^-ΔΔCt method.

Table 1: Primers for RT-qPCR.

Primer Name	Sequence (5’-3’)	Gene symbol
IL-6 forward	CTTCCATCCAGTTGCCTTCT	Il6
IL-6 reverse	CTCCGACTTGTGAAGTGGTATAG	Il6
TLR2 forward	CACTATCCGGAGGTTGCATATC	Tlr2
TLR2 reverse	GGAAGACCTTGCTGTTCTCTAC	Tlr2
CCL2 forward	CTCACCTGCTGCTACTCATTC	Ccl2
CCL2 reverse	ACTACAGCTTCTTTGGGACAC	Ccl2
TNF-α forward	TTGTCTACTCCCAGGTTCTCT	Tnf
TNF-α reverse	GAGGTTGACTTTCTCCTGGTATG	Tnf
β2m forward	GGTCTTTCTGGTGCTTGTCT	B2m
β2m reverse	TATGTTCGGCTTCCCATTCTC	B2m
18s forward	GTAACCCGTTGAACCCCATT	18s rRNA
18s reverse	CCATCCAATCGGTAGTAGCG	18s rRNA

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Todd Hewitt Broth (THB)	Becton, Dickinson and Company	DF0492078	Dissolve 30 g of the powder in 1 L of purified water. Autoclave at 121° for 15 min.
Agar	DSBIO	16C0050	Dissolve 15 g of the powder in 1 L of THB. Autoclave at 121° for 15 min.
Milli-Q Reference Water Purification System	Merck KGaA	Z00QSVCUS	Without Dnase/ Rnase
NaCl	Tianjin Kemiou Chemical Reagent Co., Ltd	10019318
Na₂HPO₄	Xilong Scientific Co., Ltd	9009012-01-09
KCl	Xilong Scientific Co., Ltd	9009017-01-09
KH₂PO₄	Xilong Scientific Co., Ltd	9009019-01-09
KOH	Xilong Scientific Co., Ltd	9009014-01-09
Glycerol	Sionpharm Chemical Reagent Co., Ltd	10010618	Diluted with equal volume of purified water, autoclave at 121° for 15 min
4% paraformaldehyde	Sionpharm Chemical Reagent Co., Ltd	80096675
25% Glutaraldehyde	Sionpharm Chemical Reagent Co., Ltd	30092436	10-fold diluted with purified water for fixation.
Ethanol	Sionpharm Chemical Reagent Co., Ltd	10009218
Chloroform	Sionpharm Chemical Reagent Co., Ltd	10006818
Spctrophotometre	DeNovix Inc.	DS-11+
Ultrasound cell crusher	NingBo Scientz Biotechnology Co.,Ltd	JY96-IIN
Centrifuge	Hitachi Koki Co., Ltd	CT15RE
Refrigerator	Aucma Co., Ltd	DW-86L500
FastRNA Pro Green Kit	MP Biomedicals	#6045-050
FastPrep-24 Instrument	MP Biomedicals	116005500
Instrument for PCR	SensoQuest GmbH	1124310110
QuantStudio 6 Flex	Thermo Fisher Scientific	4485689
SYBR Premix Ex Taq II	Takara Biomedical Technology (Beijing) Co., Ltd	RR820A
PrimeScript RT reagent kit with gDNA Eraser	Takara Biomedical Technology (Beijing) Co., Ltd	RR047A