Method Article

Using DNA-Based Tension Probes to Assess Receptor Forces Applied by Immune Cells

July 8th, 2025

In This Article

Abstract

$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Source: Ma, R. et al., DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells. J. Vis. Exp. (2021)

The video demonstrates a method for assessing receptor forces applied by immune cells using polyethylene glycol-anchored gold nanoparticles and DNA hairpin tension probes. CD8-positive T cell interactions trigger probe unfolding, emitting fluorescence while locking strands sustain the signal for quantifying the forces applied by immune cells.

Protocol

$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Oligonucleotide preparation

  1. Dissolve the ligand strand deoxyribonucleic acid (DNA) in water (18.2 MΩ resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM. Validate the concentration by using a nanodrop spectrophotometer to measure the absorbance at 260 nm and determine the final concentration based on the extinction coefficient of the oligonucleotide.
    NOTE: The ligand strand has a modification at each terminus, 5' amine, and 3' biotin, to conjugate with the fluorophore and to present....

Access restricted. Please log in or start a trial to view this content.

Results

$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Cy3B ligand strand analysis: absorbance graph (260 nm, 560 nm), mass spectrum, mass vs. error table.
Figure 1: Examples of oligonucleotide preparation. (A) HPLC chromatogram of Cy3B ligand strand purification; (B) MALDI-TOF-MS spectra of the product; (C) Table of the calculated mass and found m/z peaks.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
No conflicts of interest declared.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
3-hydroxypicolinic acid (3-HPA)Sigma56197Maldi-TOF-MS matrix
mPEG-SCBiochempegMF001023-2KSurface prep
(3-Aminopropyl)triethoxysilaneAcrosAC430941000Surface prep
10x Red blood cell lysis bufferBiolegend00-4333-57Buffer
8.8 nm gold nanoparticles, tannic acidNanocomposixcustomized orderSurface prep
Atto647N NHS esterSigma18373-1MG-FFluorophore, oligo prep
Attofluor Cell Chamber, for microscopyThermo Fisher ScientificA7816Imaging
BD Syringes only with Luer-LokBD bioscience309657Cells
Biotinylated anti-mouse CD3eebioscience13-0031-82Antibody/ligand
Biotinylated pMHC ovalbumin (SIINFEKL)NIH Tetramer Core Facility at Emory UniversityNAAntibody/ligand
Bovine serum albuminSigma735078001Block non-specific interactions
Cell strainersBiologix15-1100Cells
Coverslip Mini-Rack, teflonThermo Fisher ScientificC14784Surface prep
Cy3B NHS esterGE HealthcarePA63101Fluorophore, oligo prep
Dulbecco's phosphate-buffered saline (DPBS)Corning21-031-CMBuffer
EthanolSigma459836Surface prep
Hank's balanced salts (HBSS)SigmaH8264Buffer
Hydrogen peroxideSigmaH1009Surface prep
LA-PEG-SCBiochempegHE039023-3.4KSurface prep
Midi MACS (LS) startup kitMiltenyi Biotec130-042-301Cells
Mouse CD8+ T cell isolation kitMiltenyi Biotec130-104-075Cells
Nanosep MF centrifugal devicesPall laboratoryODM02C35Oligo prep
No. 2 round glass coverslipsVWR48382-085Surface prep
NTA-SAMDojindo Molecular TechnologiesN475-10Surface prep
P2 gelBio-rad1504118Oligo prep
Sulfuric acidEMD Millipore CorporationSX1244-6Surface prep
Sulfo-NHS acetateThermo Fisher Scientific26777Surface prep
Equipment
Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 μm653950-702Oligonucleotide preparation
Barnstead Nanopure water purifying systemThermo FisherWater
CFI Apo 100× NA 1.49 objectiveNikonMicroscopy
Cy5 cubeCHROMAMicroscopy
Evolve electron multiplying charge coupled device (EMCCD)PhotometricsMicroscopy
High-performance liquid chromatographyAgilent 1100Oligonucleotide preparation
Intensilight epifluorescence sourceNikonMicroscopy
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS)Voyager STROligonucleotide preparation
Nanodrop 2000 UV-Vis SpectrophotometerThermo FisherOligonucleotide preparation
Nikon Eclipse Ti inverted microscopeNikonMicroscopy
Nikon Perfect Focus SystemNikonMicroscopy
NIS Elements softwareNikonMicroscopy
Quad band TIRF 405/488/561/647 cubeCHROMAMicroscopy
RICM cubeCHROMAMicroscopy
TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nmCoherentMicroscopy
TRITC cubeCHROMAMicroscopy
Oligo name5' modification / 3' modificationSequence (5' to 3')Use
15mer amine locking strand5' modification: no modification
3' modification: /3AmMO/		AAA AAA CAT TTA TAC CCT ACC TALocking real-time tension signal
15mer Atto647N locking strand5' modification: Atto647N
3' modification: /3AmMO/		AAA AAA CAT TTA TAC CCT ACC TALocking real-time tension signal
15mer non-fluoresccent locking strand5' modification: no modification
3' modification: no modification		A AAA AAC ATT TAT ACLocking real-time tension signal for quantitative analysis
4.7 pN hairpin strand5' modification: no modification
3' modification: no modification		GTGAAATACCGCACAGATGCGT
TTGTATAAATGTTTTTTTCATTTAT
ACTTTAAGAGCGCCACGTAGCC
CAGC		Hairpin probe
Amine ligand strand5' modification: /5AmMC6/
3' modification: /3Bio/		CGCATCTGTGCG GTA TTT CAC TTTHairpin probe
BHQ2 anchor strand5' modification: /5ThiolMC6-D/
3' modification: /3BHQ_2/		TTTGCTGGGCTACGTGGCGCTCTT Hairpin probe
Cy3B ligand strand5' modification: Cy3B
3' modification: /3Bio/		CGCATCTGTGCG GTA TTT CAC TTTHairpin probe
Unlocking strand5' modification: no modification
3' modification: no modification		TAG GTA GGG TAT AAA TGT TTT TTT CUnlocking accumulated tension signal

Reprints and Permissions

$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Request permission to reuse the text or figures of this JoVE article

Request Permission