Transfecting Primary Macrophages with Modified mRNA

Abstract

Source: Herb, M. et al., Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA. J. Vis. Exp. (2019)

This video demonstrates the process of transfecting primary macrophages with modified mRNA encoding green fluorescent protein. These modified mRNAs, designed to reduce immunogenicity and improve its stability, ensure the successful transfection and subsequent expression of green fluorescent proteins, which is confirmed through fluorescence microscopy.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or an RNAse-degrading surfactant (Table of Materials). Ensure that all reaction tubes are RNAse-free and sterile. Use only sterile, RNAase-free water for dilutions. Exclusively use pipette tips with filters. Change pipet....

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
5-methyl-CTP (100 mM)	Jena Biosience	NU-1138S	stored at -20 °C
Antarctic phosphatase	New England BioLabs	M0289	stored at -20 °C
Antarctic phosphatase reaction buffer (10X)	New England BioLabs	B0289	stored at -20 °C
anti-NEMO/IKKγ antibody	Invitrogen	MA1-41046	stored at -20 °C
anti-β-actin antibody	Sigma-Aldrich	A2228	stored at -20 °C
Petri dishes 92,16 mm with cams	Sarstedt	8,21,473	stored at RT
CD11b Microbeads mouse and human	Miltenyi Biotec	130-049-601	stored at 4 °C
Cre recombinase + T7-Promotor forward primer	Sigma-Aldrich		5′-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3', stored at -20 °C
Cre recombinase + T7-Promotor reverse primer	Sigma-Aldrich		5′-CTAATCGCCATCTTCCAGCAGG C-3′, stored at -20 °C
DNA purification kit: QIAquick PCR purification Kit	Qiagen	28104	stored at RT
eGFP + T7-Promotor forward primer	Sigma-Aldrich		5´-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3´, stored at -20 °C
eGFP + T7-Promotor reverse primer	Sigma-Aldrich		5´-TGGTATGGCTGATTA TGATCTAGAGTCG-3´, stored at -20 °C
Fast Digest buffer (10X)	Thermo Scientific	B64	stored at -20 °C
FastDigest XbaI	Thermo Scientific	FD0684	stored at -20 °C
High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase	New England Biolabs Inc	M0491S	stored at -20 °C
IKKβ + T7-Promotor forward primer	Sigma-Aldrich		5′-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3′, stored at -20 °C
IKKβ + T7-Promotor reverse primer	Sigma-Aldrich		5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C
in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)	New England BioLabs	E2060	stored at -20 °C
LS Columns	Miltenyi Biotec	130-042-401	stored at RT
MACS MultiStand	Miltenyi Biotec	130-042-303	stored at RT
mRNA transfection buffer and reagent: jetMESSENGER	Polyplus transfection	409-0001DE	stored at 4 °C
Mutant IKKβ IKK-2S177/181E plasmid	Addgene	11105	stored at -20 °C
Mutant NEMOC54/347A plasmid	Addgene	27268	stored at -20 °C
pEGFP-N3 plasmid	Addgene	62043	stored at -20 °C
Poly(I:C)	Calbiochem	528906	stored at -20 °C
pPGK-Cre plasmid			F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C
Pseudo-UTP (100 mM)	Jena Biosience	NU-1139S	stored at -20 °C
QuadroMACS Separator	Miltenyi Biotec	130-090-976	stored at RT
Rat-anti-mouse CD11b antibody, APC-conjugated	BioLegend	101212	stored at 4 °C
Rat-anti-mouse F4/80 antibody, PE-conjugated	eBioscience	12-4801-82	stored at 4 °C
recombinant M-CSF	Peprotech	315-02	stored at -20 °C
RNA purification kit: MEGAclear transcription clean-up kit	ThermoFisher Scientific	AM1908	stored at 4 °C
RNAse-degrading surfactant: RnaseZAP	Sigma-Aldrich	R2020	stored at RT
Ultrapure LPS from E.coli O111:B4	Invivogen		stored at -20 °C
Wild type IKKβ plasmid	Addgene	11103	stored at -20 °C
Wild type NEMO plasmid	Addgene	27268	stored at -20 °C