Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

En Allelotyping PCR för att identifiera Salmonella enterica Serotyper Enteritidis, Hadar, Heidelberg, och typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Vi beskriver en multiplex PCR för snabb detektion av Salmonella enterica serotyper Enteritidis, Hadar, Heidelberg, och typhimurium. Särskilda Salmonella serotyper kan identifieras genom att rikta en multiplex PCR till gener och sekvenser som är unika för O-antigen biosyntes kluster och flagellin av en viss serovar. Serovar tilldelas sedan till en Salmonella isolera baserad på uppkomsten av specifika, storlek amplicons (PCR-produkt) som motsvarar målet allel.

Abstract

Nuvarande kommersiella PCR test för att identifiera gener salmonella mål unikt för detta släkte. Men det finns två arter, sex underarter, och över 2500 olika serotyper av Salmonella, och inte alla är lika i sin betydelse för folkhälsan. Till exempel att hitta S. enterica underarter IIIa Arizona på ett bord ägg lager gården är obetydlig jämfört med isolering av S. enterica underarter Jag serovar Enteritidis, den ledande orsaken av salmonella kopplade till konsumtionen av konsumtionsägg. Serotyper identifieras utifrån den antigena skillnader i lipopolysackarid (LPS) (O-antigen) och flagellin (H1 och H2 antigener). Dessa antigen skillnader är utseende av mångfalden av gener och alleler gen i samband med denna fenotyp.

Vi har utvecklat en allelotyping, multiplex-PCR som tangenterna på genetiska skillnader mellan fyra stora S. enterica underart jag serotyper som finns i fjäderfä och associeras med signifikant sjukdom hos människor i USA. PCR primerpar riktade till viktiga gener eller sekvenser som är unika för en specifik Salmonella serovar och utformats för att producera en amplicon med storlek specifika för den gen eller allel. Tilldelas en isolera bygger på en kombination av PCR-test resultat för specifika LPS Salmonella serovar och flagellin gen alleler. Den multiplex PCR beskrivs i denna artikel är specifika för detektion av S. enterica underarter Jag serotyper Enteritidis, Hadar, Heidelberg, och typhimurium.

Här visar vi hur du använder multiplex-PCR för att identifiera serovar för salmonella isolat.

Protocol

1. Beredning av PCR Mall

OBS: För att minimera PCR överföring kontamination är det viktigt att hålla flera viktiga viktiga steg i PCR fysiskt åtskilda från varandra: 1) mall (DNA) förberedelse, 2) PCR-installationen, och 3) gelelektrofores. Det rekommenderas också att använda barriär tips för att förhindra kultur eller reagens förorening av pipetters.

  1. Inokulera 1 ml Luria Bertani buljong eller andra komplexa medium (Brain Heart Infusion, Superbroth, etc.) med salmonella isolat från en enda isolerad koloni. Inkubera kultur över natten vid 37 ° C.
  2. Överför 1 ml till ett sterilt, 1,5 ml mikrofugrör, centrifugera bakteriell cellsuspension vid 4500 xg under ~ 2 min. till pellets celler.
  3. Dekantera supernatanten resuspendera cellpelleten i 1 ml 100% etanol och ställ i rumstemperatur i 10 min. Pellets celler som tidigare (4500 xg, 2 min.), Avlägsna supernatanten och återsuspendera cellerna i 1 ml PBS.
  4. Centrifugera cellerna (4500 xg, 2 min.), Kassera supernatanten och återsuspendera cellerna i 1 ml steril dH 2 O.
  5. Späd den slutliga cellsuspensionen 1 / 20 i dH 2 O (5 μl/95 l dH 2 O) och förvara vid -20 ° C. Hållbarheten av hela celler som PCR-mall vid -20 ° C är ca en månad.

2. PCR-Setup

OBS: Förberedelser och utlämning av PCR-reaktionsblandningen (mall, buffertar, oligonucletoideprimers, nukleotider och Taq DNA-polymeras) behöver utföras i en fysiskt separat rum dedikerade och helst göras på ett PCR / UV-arbetsstation.

Obs: PCR inrättat utrymme måste också sluten med en utsedd -20 ° C frys för förvaring av PCR-reagens (buffertar, oligonukleotid primers och nukleotider), enzymer och mall, dedikerad pipetter som för PCR-setup, Engångshandskar av latex , laboratorierock, barriär tips, mikrotiterplattor, glas kapillärerna, mikrofugrör rör, och 10% blekmedel för dekontaminering av ytor. Använd en dedikerad pipetter set (P10, P100 och P1000) att fördela PCR reagenser. Denna pipett som får aldrig lämna set-up arbetsstation.

Obs: Skaffa molekylärbiologi eller PCR grade dH 2 O och delprov 1 ml i 1,5 centrifug ml rör. Fördela alikvoteras dH 2 O efter varje användning för att undvika eventuell korskontaminering. Ett liknande tillvägagångssätt rekommenderas med andra PCR-reagenser.

Obs: Sanera arbetsområdet före användning med UV belysning och / eller torka ner ytor med 10% blekmedel. Använd laboratorierock och latexhandskar att utföra PCR-setup. Minimera och tillbaka trafik från PCR-till områden där PCR-reaktioner inkuberas i thermocylcer och PCR-produkter (amplicons) separeras på agarosgeler. Om du går tillbaka till PCR-området, förfoga över par latexhandskar du för tillfället bär och sätta på ett par nya handskar.

  1. Gör ett lager mästare grundfärg i dH 2 O till en koncentration på 5x10 -4 M. Späd primers 1 / 20 i dH 2 O (5 μl/95 l dH 2 O, 25 M). Den oligonukleotid sekvens för varje flagellin skriva primer beskrivs i tabell 1.
  2. Hämta PCR-reagens och mall från -20 ° C frys, och låt reagenser och prover för att tina upp på is. Låt Taq DNA-polymeras i frysen tills det behövs.
  3. Fördela reagenser för allelotyping PCR-reaktionsblandningen som beskrivs i tabell 1.
  4. Fördela 9μl av PCR-reaktionsblandningen i vart och ett av 10 rund botten i en steril, 96-ja, polystyren mikrotiterplatta, med början överst i kolumnen (t.ex. A1) och flytta nedåt i kolumnen till toppen av nästa.
  5. Tillsätt 1 l av dH 2 O till 9 l av PCR-mix (ingen DNA-kontroll) till den första brunnen (A1), 0.5μl av den positiva kontrollen mallarna (I / G, M skriva grundfärger-Typhimurium och Enteritidis; r/z10 skriva grundfärger-Heidelberg och Hadar, och 1,2 / e, n, x skriva grundfärger-Typhimurium och Hadar) till 9 l av PCR-blandningen i 2: a och (B1) och 1 l av Escherichia coli K12 DH5α till 9 ml av PCR-blandning i den tredje och (C1).
  6. För varje ytterligare bra (D1-H1, A2, B2), tillsätt 1 ìl av tinas exempelmall till 9 ìl av PCR-reaktionsblandningen. För I / G, M allelotyping PCR, S. enterica serovar Typhimurium (i) och enteritidis (G, M) tjänar som positiva kontroller och Salmonella serotyper Heidelberg (r) och Hadar (Z10) är de positiva kontroller för r / z 10 allelotyping multiplex PCR.
  7. Placera 10 l kapacitet glas kapillärerna till utsetts hållare för Idaho Technology Rapidcycler (8).
  8. en gång fast i hållaren, ladda varje glas kapillär med PCR-reaktionsblandningen genom att vidröra kapillär tillbotten brunnar i mikrotiterplattan. Luta innehavaren att låta vätskan flytta ner röret och ge utrymme mellan ändarna och PCR-mix innan svetsning i provrör av glas med en butan brännare för att täta båda ändarna av kapillärerna.
  9. Placera kapillärrör och hållaren i Idaho Technology Rapidcycler och använda termocykler program som beskrivs i tabell 1 för olika allelotyping primers för att köra PCR.
  10. Gå vidare till gelelektrofores steg när termocykler programmet är genomfört.

3. Gelelektrofores

OBS: Använd en annan skyddsrock avsedda för användning i elektrofores labb och ett par nya Engångshandskar av latex.

Anm: Använd UV-skyddsglasögon eller visir och alltid var skyddshandskar vid hantering etidiumbromid, speciellt agarosgeler.

  1. Bereda 100 ml smält 1,5% (w / v) molekylärbiologi kvalitet agaros i 1xTAE (eller 1X TBE) elektrofores buffert (7) genom att upprepade gånger värma upp agaros suspension i en mikrovågsugn inställd på 20% effekt i 2-5 min intervall med periodisk visuell inspektion. Ställ den smälta agarosen i 60 ° C vattenbad tills den jämvikt med att temperaturen på vattenbadet.
  2. Ställ in gelen mögel med kam innan häller den smälta agarosen. Välj en gel kam med tillräcklig tänder att producera tillräckligt med brunnar för kontroller, prover, och minst 3 molekylär standarder vikt för deras placeringar i ändarna och mitten av agarosgel.
  3. Tillsätt 2 ìl etidiumbromid (10 mg / ml) till 100 ml av smält 1,5% (w / v) agaros i 1xTAE (eller TBE), snurra försiktigt flaskan för att blanda, undvika producera bubblor, och försiktigt hälla innehållet i flaskan i mitten av gelen mögel i 15 10 cm agarosgel. Använd kanten av mjukpapper eller pappershandduk för att avlägsna eventuella bubblor i agarosgel.
  4. Låt gelen mögel i rumstemperatur tills agaros stelnar (~ 30-45 min). Överför gelen facket med gel & kam till dränkbara, horisontell elektrofores kammare som innehåller 1X TAE (eller 1X TBE) elektrofores buffert. Ta försiktigt bort kammen från agarosgel.
  5. Kontrollera placeringen av gelen facket i förhållande till katoden eller positiva polen på elektrofores kammare att vara säker på denna pol är på botten av gelen. OBS: Kom ihåg den negativt laddade DNA vandrar mot katoden (dvs "kör till rött").
  6. Foder 200 l DNA molekylvikt markörer (0,25 mikrogram / l) med 40 ìl 6X DNA laddningsfärg. Belastning 4,8 ìl av förblandade DNA Molekylviktsmarkör XIV till den första, mellersta och sista brunnar.
  7. Ladda varje PCR-prover som börjar med såväl 2 och avancerar till varje efterföljande väl, rör sig från vänster till höger. Undvik belastning provet i någon av brunnarna innehåller molekylvikt standarden.
  8. För att ladda prov i varje glas kapillär:
    1. Ta bort varje kapillär från hållaren och etch båda ändar av kapillär med ett glas fräs.
    2. Placera tummen och pekfingret på båda händerna på vardera sidan av kapillära märkt av glas saxen och knäppa kapillär.
    3. Placera kapillära dispensern på slutet motsatsen till PCR-reaktionsblandningen och långsamt vrida kolven medurs tills vätskan är själva botten av röret.
    4. Placera kapillära i brunnen som ska laddas och långsamt vrida kolven medurs för att dosera Ficoll-vägda provet i agarosen väl. Var noga med att inte punktera väl med kapillär eller införa en luftbubbla i brunnen genom att vrida alltför mycket förbi när den sista av vätskan lämnar kapillär.
  9. När alla prover och normer är laddade, ställ in konstant spänning på strömförsörjningen till 90 V (9 volt / cm agarosgel).
  10. Sluta elektrofores när den gula färgen (Taurazine) fronten är 1 cm från botten av gelen.
  11. När elektrofores är klar överför gel till en UV-transilluminator att visualisera DNA-fragment och molekylvikt standard. Fånga bild på Polaroid film med en polaroidkamera med orange glas filter (inställningar: 2 x och 4,5 y) eller som en digital bild med en CCD-kamera och skriva ut bilden med en termisk skrivare.
  12. Placera kapillär ägare i 10% blekmedel i 15-30 min. Skölj tre gånger med dH 2 O och lägg tillbaka i PCR-installation rummet lufttorka.

4. Representant Multiplex PCR-resultat

Resultat för allelotyping PCR av Salmonella-isolat 1-10 visas i figur 1 (körfält 3-12) och tolkas enligt följande. En O-allelen märkning ges av Salmonella isolera baserat på amplicon (PCR-produkten) matchning i storlek till PCR-kontroll och som förutspås för O-allelen primer set används (3): B-560bp, C1-340bp, C2-400 BP, D1-620 BP, och E1-280 BP. För isolaten som testades med O allelotyping PCR (Fig. 1A), vi tilldelas O-alleler B (körfält 10 -13), C1 (körfält 7-9), C2 (körfält 4, 5), D1 (Lane 3) och E1 (Lane 6) till tio Salmonella-isolat testas i gränderna 3-12. Samma Salmonella-isolat testades, i samma ordning som figur. 1A, för H1 alleler i, g, m, r, och Z10 (Fig. 1B, C). Återigen är en H1 allelen tilldelas varje isolera beroende av närvaron av en amplicon matchning i storlek till PCR-kontroll och som förutses för de 4 H1 allelen primer set används (3): i-510 bp (Figur 1B, Lane 2 ), G, M-310 bp (Figur 1B, Lane 2), R-170 bp (Figur 1C, gränd 2), och Z10-360 bp (Figur 1C, körfält 2). H1 alleler tilldelades en av de tio Salmonella-isolat: i - isolerar 3 och 8 (Fig. 1B, körfält 5 & 10), G, M-stammarna 1 och 5 (Fig. 1B, körfält 3 och 7), r för att isolerar 6 och 9 (fig. 1C, körfält 8 & 11);. och Z10 till isolerar 2, 7 och 10 (fig. 1C, banor 4, 9, & 12) Salmonella isolera 4 var negativt för de fyra testade H1 alleler. Slutligen var Salmonella-isolat testades med PCR för H2-alleler förknippade med 1,2, 1,5, 1,6, 1,7 antigen komplex och e, n, x, e, n, Z15 antigen komplex. Primern satser för H2 1,2, 1,5, 1,6, 1,7 komplexa och H2 e, n, x, e, n, Z15 komplexa producera 290 bp och 150 bp amplicons respektive (3). Grundfärgen ställer kan inte skilja vissa H2 alleler inom antingen H2 antigen komplex för att tilldela en slutgiltig allel typ, ex. 1,2, med ett isolat (3) Salmonella-isolat 4, 6, var 8-10 positivt för H2 alleler i samband med H2 1,2,. 1,5, 1,6, 1,7 antigen komplexa, samtidigt som isolerar 2 och 7 var positiva för H2 alleler i samband med e, n, x, e, n, Z15 antigen komplex (data visas inte). Medan Salmonella-isolat 1, 3 och 5 var negativa för de två H2 antigen komplex, bara isolerar 1 och 5 var negativa för H2 flagellin, som bestäms med hjälp av en generisk H2 flagellin PCR (1) (data inte visa). Dessa resultat sammanfattas i tabell 2 tillsammans med presumtiva Salmonella serovar tilldelas varje isolera.

Figur 1
Figur 1. Multiplex PCR för identifiering av specifika O och H alleler förknippade med S. enterica serotyper Enteritidis, Hadar, Heidelberg, och typhimurium. (A) O Allel Multiplex PCR. (B, C) H1 Allel Multiplex PCR för att identifiera Flagellin Alleles: I / G, M (B) och r/z10 (C). Lanes 1 och 13: 100 bp stege (Promega, Madison, WI), körfält 2: multiplexa PCR-kontroller för O-alleler B, C1, C2, D1 och E (A), H1 alleler i / G, M (B), och H1 alleler r/z10 (C), och körfält 3-12: Salmonella-isolat 1-10 (tabell 2).

PCR Master Mix Termocykler (Rapidcycler)
Reagenser Sammansättning / koncentration Belopp   Parametrar Förväntad storlek
H1 i / g, m
dH 2 O 63 l Program 1 94 ° C i 1 min
10X PCR-buffert 20 mM MgCl 2 10 l Program 2 94 ° C under 1 s
500 mMTris pH8 55 ° C under 1 s
2,5 mg / ml BSA 72 ° C i 20 s
5% Ficoll 400 För 40 cykler
10 mMTartrazine Slope = 2,0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 l Program 3 72 ° C i 4 min 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 l
Primer G, M (f) * GCAGCAGCACCGGATAAAG 2 l 310 bp
Primer G, M (r) * CATTAACATCCGTCGCGCTAG 2 l
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 enheter / l 2 l
90 l
H1 r / z 10
dH 2 O 55 l Program 1 94 ° C i 1 min
10X PCR-buffert 30 mM MgCl 2 10 l Program 2 94 ° C under 1 s
500 mMTris pH8 55 ° C under 1 s
2,5 mg / ml BSA 72 ° C i 20 s
5% Ficoll 400 För 40 cykler
10 mMTartrazine Slope = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Program 3 72 ° C i 4 min 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 enheter / l 2 l
90 l
PCR Master Mix Termocykler (Rapidcycler)
Reagenser Sammansättning / koncentration Belopp   Parametrar Förväntad storlek
H2 1,2 / e, n, x
dH 2 O 63,6 l Program 1 94 ° C i 1 min
10X PCR-buffert 20 mM MgCl 2 10 l Program 2 94 ° C under 1 s
500 mMTris pH8 55 ° C under 1 s
2,5 mg / ml BSA 72 ° C i 20 s
5% Ficoll 400 För 40 cykler
10 mMTartrazine Slope = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 l Program 3 72 ° C i 4 min 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 l
Primer e, n, X (f) * TAACTGGCGATACATTGACTG 2 l 150 bp
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 l
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 enheter / l 2 l
90 l
Generic H2
dH 2 O 72 l Program 1 94 ° C i 1 min
10X PCR-buffert 30 mM MgCl 2 10 l Program 2 94 ° C i 10 s
500 mMTris pH8 45 ° C i 10 s
2,5 mg / ml BSA 72 ° C i 35 s
5% Ficoll 400 För 40 cykler
10 mMTartrazine Slope = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 l Program 3 72 ° C i 4 min 1500 bp
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 l
dNTP 10 mM 2 l
Taq 5 enheter / l 2 l
90 l

Tabell 1. Protokoll för salmonella flagellinallelotyping PCR: sammansättning, villkor och förväntade resultat.

* Arbetsgruppen lager Koncentrationen av PCR-oligonukleotid primer är 25 mikroM

Isolera O Allel H1 Allel H2 Allel Serovar
  B C1 C2 D1 E Jag G, M r Z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Generic 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Okänd
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis eller Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabell 2. Allelotyping PCR-resultat (Fig. 1) och Salmonella serovar Beteckning Baserat på identifiering av O, H1 och H2 Alleles

> 1 H2 PCR ger en 1,5 kb amplicon för alla Salmonella innehav H2 flagellin, oberoende av H2-allelen (1). Denna PCR används för att skilja monofasiska från bifasisk Salmonella.
2 H2 multiplexa PCR inte kan skilja mellan de olika alleler för H2 1,2, 1,5, 1,6, 1,7 antigen komplex (3).
3 Phage konvertering av S. enterica serovar Hadar förändrar LPS O-antigen att producera serovar Istanbul. O allelotyping PCR inte kan urskilja dessa subtila genetiska / antigena förändringar.

Serovar 1 O Allel H1 Allel H2 Allel
  B C1 C2 D1 E Jag G, M r Z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Generic 2
Kalifornien + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Rwanda - - - + - - - - + - + +
TREGUIER - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabell 3. Salmonella enterica serotyper Märkt med Allelotyping PCR

1 Den serotyper markeras med fet stil är de som oftare drabbar diagnostiska eller mat mikrobiologiska laboratoriet.
2 H2 PCR ger en 1,5 kb amplicon för alla Salmonella innehav H2 flagellin, oberoende av H2-allelen (1). Denna PCR används för att skilja monofasiska från bifasisk Salmonella.
3 Phage konvertering av S. enterica serovar Hadar förändrar LPS O-antigen att producera serovar Istanbul. O allelotyping PCR inte kan urskilja dessa subtila genetiska / antigena förändringar.

Discussion

De flesta kommersiellt tillgängliga PCR-test för upptäckt av Salmonella mål gener som är unika för släktet (ex. Inva). Men inte alla Salmonella är lika i sin förmåga att orsaka sjukdom hos människor eller förekomsten i djurpopulationer. Tidig upptäckt av antigena olikheter i Salmonella LPS O-antigen och flagellinH1 och H2-antigener har lett till differentieringen av Salmonella i över 2.500 serotyper baserat på dessa antigena skillnader. Det finns 46 olika O-antigener och 86 distinkta flagellin (H) antigen som identifierats i släktet Salmonella. Salmonella kan ha en (H1) eller två olika (H1 & H2) flagellins. De olika kombinationer av O, H1 och H2 antigener konto för 2500 Salmonella serotyper igen idag. En serovar tilldelas baseras på antigena formel härrör från identifiering av enskilda O och H antigener. De antigena formel skrivs som O: H1: H2, och där - hänvisar till frånvaron av H1 eller H2 flagellin och "NT" (icke-typningsbara) för Salmonella negativt för O-antigen, "". Till exempel är det serovar Typhimurium tilldelats ett S. enterica isolera med antigena formel B: I: 1,2, medan Enteritidis ges till ett isolat med formeln D1: G, M: -. Detta antigen variation i Salmonella befolkningen är den yttre manifestationen av skillnader på nukleotid nivå som därför lätt kan utnyttjas av PCR.

Vi har identifierat de genetiska skillnaderna är förknippade med specifika O och H alleler för att utveckla en allelotyping PCR för att identifiera S. enterica serotyper: Enteritidis, Hadar, Heidelberg, och Typhimurium (3). Den riktiga uppdrag och rapportering av Salmonella serovar kräver testning för alla alleler i samband med O: H1: H2 antigen formler för Enteritidis (D1: G, M: -), Hadar (C2: Z10: e, n, x), Heidelberg (B : R: 1,2), och Typhimurium (B: I: 1,2). Utan kunskap om O-allel eller antigen, konstaterandet av H1 g, inte m allel ensamt inte nödvändigtvis identifiera Salmonella isoleras så Enteritidis som andra Salmonella serotyper: Agona, Kalifornien, och Montevideo, också har samma allel. Medan allelotyping PCR var ursprungligen avsedd att upptäcka i förgrunden nämns Salmonella serotyper, kan detta test identifiera ytterligare 19 serotyper (tabell 3). Vår allelotyping PCR var ursprungligen avsedd att upptäcka O och H alleler. I praktiken har det blivit mer praktiskt och kostnadseffektivt för oss att identifiera O-antigen genom att glida agglutinationstest, med hjälp av O-specifika immunsera, istället för att genomföra O allelotyping PCR när man arbetar med isolerade Salmonella kulturer. Däremot rekommenderar vi att du använder O allelotyping PCR om ditt labb använder denna PCR som en skärm (2) eller för att skriva salmonella-isolat in på FTA-kort (6), och inkluderar en Salmonella-specifika PCR med första skärmen av prover (4 ). Begränsa allelotyping PCR till endast de prover som identifierats som salmonella med PCR eller biokemiska / antigena tester.

Protokollet beskrivs i denna artikel har optimerats för användning med Idaho Technology Rapidcycler, en hetluft termocykler som gör att man kan skala ner reaktion volymer och driver reaktionsbetingelserna på kortare tid än många thermocyclers värmeblock. Att anpassa detta protokoll för användning med en värmeblock termocykler kan kräva att optimera reaktionsbetingelser empiriskt genom att sänka / höja glödgning temperaturer, justering av grundfärg koncentrationer, eller justera MgCl 2 koncentrationer. Till exempel har vi varit tvungna att anpassa protokollet för MJ Research PTC-200 termocykler enligt följande. Arbeta med samma reaktion volymer som beskrivs i tabell 1, arbetsmiljö beståndet concentrationof I primer som späddes till 2,5 mikroM var glödgning temperaturen sänks från 55 ° C till 45 ° C och inkubationstiderna vid denaturering, hybridisering och utbyggnad steg förlängdes till 20 s för I / G, M allelotyping PCR. Efter att ha lämpliga positiva och negativa kontroller är viktiga i den inledande start och optimering för PCR, inklusive offentliggjord protokoll. Vi rekommenderar att förvärva känd Salmonella serotyper, särskilt Anatum (E1: e, h: 1,6), enteritidis (D1: G, M: -), Hadar (C2: Z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: G, M, S: 1,2,7) och Typhimurium (B: I: 1,2), och ett laboratorium Escherichia coli K12 stam (DH5α, LE393, JM109 etc. ) som positiva och negativa kontroller respektive för allelotyping PCR-test som beskrivs i denna artikel. Flera av dessa Salmonella serotyper kommer att fungera som antingen positiva eller negativa kontroller, beroende på vilken allelen testas.

Vissa försiktighetsåtgärder och riktlinjer måste följas när de utför denna och annan diagnostik PCR. Först den fysiska separationenav mall förberedelser, PCR-och gelelektrofores är avgörande för att förhindra eventuella PCR överföring förorening och felaktig rapportering av falskt positiva. Dessutom är införandet av lämpliga kontroller som krävs i varje rutin PCR eftersom dessa kontroller identifiera problem som kan uppstå och hjälpa till med tolkning av resultat (5). Viktigast är konsekvent viktigt, särskilt med avseende på den genom elektrofores förutsättningarna för amplicon (PCR-produkten) upptäckt andestimation av amplicon storlek. För att illustrera detta, upphängda vi medvetet elektrofores tidigare än planerat i Figur 1A. Den molekylvikt standarder (körfält 1 och 13) och en positiv kontroll (Lane 2) inte är tillräckligt åtskilda att exakt uppskatta storlekar eller observera separation av DNA-fragment där det finns små skillnader (~ 50 bp) i storlek. Tillräcklig åtskillnad av DNA-fragment, särskilt molekylvikt standarder är avgörande då rapporteringen positiva är beroende av korrekt uppskattning av amplicon storlek och skilja "sant positiva" från icke-specifik amplicons som ibland observeras i den dagliga driften av PCR (5 ). Till exempel finns det en icke-specifik amplicon i figur 1B, körfält 7 (~ 700 bp i storlek). Hade elektrofores avbrutits för tidigt, då färgen fronten var först vid halv sätt punkt i agarosgel, skulle det vara lite skillnad mellan 500 bp och 700 bp fragment DNA. Därför skulle prov på bana 7 har felaktigt redovisats som positiv för både jag och G, M alleler.

Slutligen måste man inse de begränsningar som är förknippade med någon test. Flera av de H1/H2 allelotyping PCR har inte diskriminerande makt att urskilja subtila genetiska skillnader i alleler som hör till H2 1,2, 1,5, 1,6, 1,7 antigen komplex, e, n, x / e , n, Z15 antigen komplex och H1 G-antigen komplex, vilket inkluderar G, M allel. En eller två aminosyror förändringar står för olika epitoper förekommer i dessa flagellar antigener. Det var därför svårt för oss att designa primers som kan utnyttja dessa ibland enda skillnader baspar i flagellin gensekvens (3). Till exempel Salmonella serotyper Dublin (D1: g, tfn: -) och Berta (D1: F, G, T: -) är PCR-positiva med våra g, mallelotyping grundfärger. H2 allelotyping grundfärg kan inte skilja Typhimurium (B: I: 1,2) från Lagos (B: I: 1,5), Heidelberg (B: R: 1,2) från Bradford (B: R: 1,5), Winneba (B: R: 1,6), eller Remo (B: R: 1,7), eller Hadar (C2: Z10: e, n, x) från Glostrup (C2: Z10: e, n, Z15). Även sannolikheten för att möta några av dessa serotyper: Lagos, Bradford, Winneba, Remo eller Glustrup är avlägset, det är en möjlighet och kräver antingen att ge disclaimer om testerna "begränsning eller annan bekräftande test.

Sammanfattningsvis identifierar denna PCR-baserad serotypning snabbt S. enterica serotyper Enteritidis, Hadar, Heidelberg och typhimurium och O, H1 och H2 alleler i samband med 19 ytterligare serotyper. Denna analys är en snabb, kostnadseffektivt alternativ till traditionell mikrobiologisk metod för serotypning salmonella.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Detta arbete har stötts av USDA Grants 1999-35212-8680, 2005-01.378 och 2010-04288-01, USDA Formel fonder och staten Georgiens veterinärmedicin jordbruksforskning Grant. Protokollet beskrivs i denna publikation har utvecklats för att användas av studenter som en del av riktad forskning kurser: MIBO 4900L, Gene 4960H, BCMB 4960L och Biol 4960H vid University of Georgia och användas av eleverna på flera molekylära projekt epidemiologisk forskning i Maurer laboratorium. Vi vill tacka de många studerande som har utfört forskning inom Maurer och Lee laboratorier, och vår avdelning stol, John Glisson för att stödja våra ansträngningar för att integrera grundutbildning undervisning med forskning.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
En Allelotyping PCR för att identifiera<em> Salmonella enterica</em> Serotyper Enteritidis, Hadar, Heidelberg, och typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter