RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
Research Article
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
PCR has emerged as a common technique in many molecular biology laboratories. Provided here is a quick guide to several conventional PCR protocols. Because each reaction is a unique experiment, optimal conditions required to generate a product vary. Understanding the variables in a reaction will greatly enhance troubleshooting efficiency, thereby increasing the chance to obtain the desired result.
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase.
PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to:
● Set up reactions and thermal cycling conditions for a conventional PCR experiment
● Understand the function of various reaction components and their overall effect on a PCR experiment
● Design and optimize a PCR experiment for any DNA template
● Troubleshoot failed PCR experiments
1. Designing Primers
Designing appropriate primers is essential to the successful outcome of a PCR experiment. When designing a set of primers to a specific region of DNA desired for amplification, one primer should anneal to the plus strand, which by convention is oriented in the 5' → 3' direction (also known as the sense or nontemplate strand) and the other primer should complement the minus strand, which is oriented in the 3' → 5' direction (antisense or template strand). There are a few common problems that arise when designing primers: 1) self-annealing of primers resulting in formation of secondary structures such as hairpin loops (Figure 1a); 2) primer annealing to each other, rather then the DNA template, creating primer dimers (Figure 1b); 3) drastically different melting temperatures (Tm) for each primer, making it difficult to select an annealing temperature that will allow both primers to efficiently bind to their target sequence during themal cycling (Figure 1c) (See the sections CALCULATING MELTING TEMPERATURE (Tm) and MODIFICATIONS TO CYCLING CONDITIONS for more information on Tms).
Notes:
2. Materials and Reagents
3. Setting up a Reaction Mixture
4. Basic PCR Protocol
Notes:
5. Calculating Melting Temperature (Tm)
6. Setting Up Thermal Cycling Conditions
7. Important Considerations When Troubleshooting PCR
If standard PCR conditions do not yield the desired amplicon, PCR optimization is necessary to attain better results. The stringency of a reaction may be modulated such that the specificity is adjusted by altering variables (e.g., reagent concentrations, cycling conditions) that affect the outcome of the amplicon profile. For example, if the reaction is not stringent enough, many spurious amplicons will be generated with variable lengths. If the reaction is too stringent, no product will be produced. Troubleshooting PCR reactions may be a frustrating endeavor at times. However, careful analysis and a good understanding of the reagents used in a PCR experiment can reduce the amount of time and trials needed to obtain the desired results. Of all the considerations that impact PCR stringency, titration of Mg2+ and/or manipulating annealing temperatures likely will solve most problems. However, before changing anything, be sure that an erroneous result was not due to human error. Start by confirming all reagents were added to a given reaction and that the reagents were not contaminated. Also take note of the erroneous result, and ask the following questions: Are primer dimers visible on the gel after electrophoresis (these run as small bands <100 b near the bottom of the lane)? Are there non-specific products (bands that migrate at a different size than the desired product)? Was there a lack of any product? Is the target DNA on a plasmid or in a genomic DNA extract? Also, it is wise to analyze the G-C content of the desired amplicon.
8. Manipulating PCR Reagents
Understanding the function of reagents used on conventional PCR is critical when first deciding how best to alter reaction conditions to obtain the desired product. Success simply may rely on changing the concentration of MgCl2, KCl, dNTPs, primers, template DNA, or DNA polymerase. However, the wrong concentration of such reagents may lead to spurious results, decreasing the stringency of the reaction. When troubleshooting PCR, only one reagent should be manipulated at a time. However, it may be prudent to titrate the manipulated reagent.
9. Additive Reagents
Additive reagents may yield results when all else fails. Understanding the reagents and what they are used for is critical in determining which reagents may be most effective in the acquisition of the desired PCR product. Adding reagents to the reaction is complicated by the fact that manipulation of one reagent may impact the usable concentration of another reagent. In addition to the reagents listed below, proprietary commercially available additives are available from many biotechnology companies.
10. Additives That Benefit G-C Rich Templates
Note:
dc7GTP attenuates the signal of ethidium bromide staining which is why it is used in a 3:1 ratio with dGTP.
11. Additives That Help PCR in the Presence of Inhibitors
12. Modifications to Cycling Conditions
Other PCR protocols are more specialized and go beyond the scope of this paper. Examples include RACE-PCR, Multiplex-PCR, Vectorette-PCR, Quantitative-PCR, and RT-PCR.
13. Representative Results
Representative PCR results were generated by following the basic PCR protocols described above. The results incorporate several troubleshooting strategies to demonstrate the effect of various reagents and conditions on the reaction. Genes from the budding yeast Saccharomyces cerevisiae and from an uncharacterized Mycobacteriophage were amplified in these experiments. The standard 3-step PCR protocol outlined in Table 2 was employed for all three experiments described below.
Before setting up the PCR experiment, the genomic DNA from both S. cerevisiae and the Mycobacteriophage were quantified and diluted to a concentration that would allow between 104 and 107 molecules of DNA per reaction. The working stocks were prepared as follows. A genomic yeast DNA preparation yielded 104 ng/μl. A dilution to 10 ng/μl was generated by adding 48 μl into 452 μl of TE pH 8.0 buffer. Since the S. cerevisiae genome is about 12.5 Mb, 10 ng contain 7.41 X 105 molecules. The genomic Mycobacteriophage DNA preparation yielded 313 ng/μl. A dilution to 2 ng/μl was generated by adding 6.4 μl into 993.6 μl of TE pH 8.0 buffer. This phage DNA is about 67 Kb. Thus, 1 ng contains 2.73 X 107 molecules, which is at the upper limit of DNA generally used for a PCR. The working stocks were then used to generate the Master Mix solutions outlined in Table 7. Experiments varied cycling conditions as described below.
In Figure 3a, genomic DNA from S. cerevisiae was used as a template to amplify the GAL3 gene, which encodes a protein involved in galactose metabolism. The goal for this experiment was to determine the optimal Mg2+ concentration for this set of reagents. No MgCl2 was present in the original PCR buffer and had to be supplemented at the concentrations indicated with a range tested from 0.0 mM to 5.0 mM. As shown in the figure, a PCR product of the expected size (2098 bp) appears starting at a Mg2+ concentration of 2.5 mM (lane 6) with an optimal concentration at 4.0 mM (lane 9). The recommended concentration provided by the manufacturer was 1.5 mM, which is the amount provided in typical PCR buffers. Perhaps surprisingly, the necessary concentration needed for product formation in this experiment exceeded this amount.
A different DNA template was used for the experiment presented in Figure 3b. Genomic DNA from a Mycobacteriophage was used to amplify a conserved 566 bp DNA segment. Like the previous experiment, the optimal Mg2+ concentration had to be determined. As shown in Figure 3b, amplification of the desired PCR product requires at least 2.0 mM Mg2+ (lane 5). While there was more variability in the amount of product formed at increasing concentrations of MgCl2, the most PCR product was observed at 4 mM Mg2+ (lane 9), the same concentration observed for the yeast GAL3 gene.
Notice that in the experiments presented in Figures 3A and 3B, a discrete band was obtained using the cycling conditions thought to be optimal based on primer annealing temperatures. Specifically, the denaturation temperature was 95 °C with an annealing temperature of 61 °C, and the extension was carried out for 1 minute at 72 °C for 30 cycles. The final 5 minute extension was then done at 72 °C. For the third experiment presented in Figure 3c, three changes were made to the cycling conditions used to amplify the yeast GAL3 gene. First, the annealing temperature was reduced to a sub-optimal temperature of 58 °C. Second, the extension time was extended to 1 minute and 30 seconds. Third, the number of cycles was increased from 30 to 35 times. The purpose was to demonstrate the effects of sub-optimal amplification conditions (i.e., reducing the stringency of the reaction) on a PCR experiment. As shown in Figure 3c, what was a discrete band in Figure 3a, becomes a smear of non-specific products under these sub-optimal cycling conditions. Furthermore, with the overall stringency of the reaction reduced, a lower amount of Mg2+ is required to form an amplicon.
All three experiments illustrate that when Mg2+ concentrations are too low, there is no amplicon production. These results also demonstrate that when both the cycling conditions are correctly designed and the reagents are at optimal concentrations, the PCR experiment produces a discreet amplicon corresponding to the expected size. The results show the importance of performing PCR experiments at a sufficiently high stringency (e.g., discreet bands versus a smear). Moreover, the experiments indicate that changing one parameter can influence another parameter, thus affecting the reaction outcome.
| Reagent | Concentration of stock solutions | Volume | 13X ** Master Mix |
Final Concentration |
| Sterile H2O | Q.S. to 50 μl | Q.S. to 650 μl | ||
| PCR Buffer | 10X | 5 μl | 65 μl | 1X |
| dNTP's | 10 mM | 1 μl | 13 μl | 200 μM |
| MgCl2 | 25 mM | 3 μl | 39 μl | 1.5 mM |
| Forward Primer | 20 μM = 20 pmol/μl | 1 μl | 13 μl | 20 pmol |
| Reverse Primer | 20 μM = 20 pmol/μl | 1 μl | 13 μl | 20 pmol |
| Template DNA | Variable | Variable | Variable | ~105 Molecules |
| Taq DNA Polymerase | 5 Units/μl* | 0.5 μl | 6.5 μl | 2.5 Units |
| 50 μl/Reaction |
Table 1. PCR reagents in the order they should be added.
*Units may vary between manufacturers
** Add all reagents to the Master Mix excluding any in need of titration or that may be variable to the reaction. The Master Mix depicted in the above table is calculated for 11 reactions plus 2 extra reactions to accommodate pipette transfer loss ensuring there is enough to aliquot to each reaction tube.
| Standard 3-step PCR Cycling | |||
| Cycle step | Temperature | Time | Number of Cycles |
| Initial Denaturation | 94 °C to 98 °C | 1 minute | 1 |
| Denaturation Annealing Extension |
94 °C 5 °C below Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and DNA polymerase dependent |
25-35 |
| Final Extension | 70 °C to 80 °C | 5 minutes | 1 |
| Hold* | 4 °C | ∞ | 1 |
Table 2. Standard 3-step PCR Cycling.
* Most thermal cyclers have the ability to pause at 4°C indefinitely at the end of the cycles.
| 2-step PCR Cycling | |||
| Cycle step | Temperature | Time | Number of Cycles |
| Initial Denaturation | 94 °C to 98 °C | 1 minute | 1 |
| Denaturation Annealing/Extension |
94 °C 70 °C to 80 °C |
10 to 60 seconds Amplicon and DNA polymerase dependent |
25-35 |
| Final Extension | 70 °C to 80 °C | 5 minutes | 1 |
Table 3. 2-step PCR Cycling.
| Hot Start PCR Cycling | |||
| Cycle step | Temperature | Time | Cycles |
| Initial Denaturation | 60 °C to 95 °C | 5 minute then add DNA polymerase | 1 |
| Denaturation Annealing Extension |
94 °C 5 °C below Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and DNA polymerase dependent |
25-35 |
| Final Extension | 70 °C to 80 °C | 5 minutes | 1 |
Table 4. Hot Start PCR Cycling.
| Touchdown PCR Cycling | |||
| Cycle step | Temperature | Time | Cycles |
| Initial Denaturation | 94 °C to 98 °C | 1 minute | 1 |
| Denaturation Annealing Extension |
94 °C X =10 °C above Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and DNA polymerase dependent |
2 |
| Denaturation Annealing Extension |
94 °C X-1 °C reduce 1 °C every other cycle 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and polymerase dependent |
28 |
| Denaturation Annealing Extension |
94 °C 5 °C below Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and DNA polymerase dependent |
20-25 |
| Final Extension | 70 °C to 80 °C | 5 minutes | 1 |
Table 5. Touchdown PCR Cycling.
| Slowdown PCR Cycling | |||
| Cycle step | Temperature | Time | Cycles |
| Initial Denaturation | 94 °C to 98 °C | 1 minute | 1 |
| Denaturation Annealing Extension |
94 °C X °C =10 °C above Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and polymerase dependent |
2 |
| Denaturation Annealing Extension |
94 °C X-1 °C reduce 1 °C every other cycle 70 °C to 80 °C* |
10 to 60 seconds 30 seconds Amplicon and polymerase dependent |
28 |
| Denaturation Annealing Extension |
94 °C 5 °C below Tm 70 °C to 80 °C |
10 to 60 seconds 30 seconds Amplicon and polymerase dependent |
20-25 |
| Final Extension | 70 °C to 80 °C | 5 minutes | 1 |
Table 6. Slowdown PCR Cycling.
*For slowdown PCR, the ramp speed is lowered to 2.5 °C s-1 with a cooling rate of 1.5 °C s-1 for the annealing cycles.
| Stock Solution | Volume added to 50 μl reaction | 13 X Yeast Master Mix | 13 X Phage Master Mix | Final Concentration | |||||||
| Sterile H2O | q.s. to 50 μl = 31 μl or 30.5 | q.s. to 650 μl = 396.5 | q.s. to 520 μl = 403 μl | ||||||||
| PCR Buffer | 10X | 5 μl | 65 μl | 65 μl | 1X | ||||||
| dNTP's | 10 mM | 1 μl | 13 μl | 13 μl | 200 μM | ||||||
| MgCl2 | Titration | Added to each reaction | Added to each reaction | Added to each reaction | Variable see titration | ||||||
| Forward Primer | 20 μM = 20 pmol/μl | 1 μl | 13 μl | 13 μl | 20 pmol | ||||||
| Reverse Primer | 20 μM = 20 pmol/μl | 1 μl | 13 μl | 13 μl | 20 pmol | ||||||
| Template DNA | 2 ng/μl phage or 10 ng/μl Yeast | 0.5 μl Phage or 1 μl Yeast | 6.5 μl | 13 μl | ~107 Molecules Phage or ~105 Molecules Yeast | ||||||
| Polymerase | 0.5 Units/μl** | 0.5 μl | 6.5 μl | 6.5 μl | 0.5 Units/Reaction | ||||||
| 40 μl + 10(Titration) μl/ Reaction | |||||||||||
| TITRATION | |||||||||||
| [MgCl2] | 0.00 mM | 0.5 mM | 1.0 mM | 1.5mM | 2.0 mM | 2.5 mM | 3.0 mM | 3.5 mM | 4.0 mM | 4.5 mM | 5.0 mM |
| MgCl2 | 0.00 μl | 1.00 μl | 2.00 μl | 3.0 μl | 4.00 μl | 5.00 μl | 6.00 μl | 7.00 μl | 8.00 μl | 9.00 μl | 10.00 μl |
| H2O | 10.00 μl | 9.00 μl | 8.00 μl | 7.00 μl | 6.00 μl | 5.00 μl | 4.00 μl | 3.00 μl | 2.00 μl | 1.00 μl | 0.00 μl |
Table 7. Titration of Mg2+ used in Figure 3.

Figure 1. Common problems that arise with primers and 3-step PCR amplification of target DNA. (a) Self-annealing of primers resulting in formation of secondary hairpin loop structure. Note that primers do not always anneal at the extreme ends and may form smaller loop structures. (b) Primer annealing to each other, rather than the DNA template, creating primer dimers. Once the primers anneal to each other they will elongate to the primer ends. (c) PCR cycles generating a specific amplicon. Standard 3-step PCR cycling include denaturation of the template DNA, annealing of primers, and extension of the target DNA (amplicon) by DNA polymerase.

Figure 2. Ice bucket with reagents, pipettes, and racks required for a PCR. (1.) P-200 pipette, (2.) P-1000 pipette, (3.) P-20 pipette, (4.) P-10 pipette, (5.) 96 well plate and 0.2 ml thin walled PCR tubes, (6.) Reagents including Taq polymerase, 10X PCR buffer, MgCl2, sterile water, dNTPs, primers, and template DNA, (7.) 1.8 ml tubes and rack.

Figure 3. Example of a Mg2+ titrations used to optimize a PCR experiment using a standard 3-step PCR protocol. (a) S. cerevisiae Yeast genomic DNA was used as a template to amplify a 2098 bp GAL3 gene. In lanes 1 - 6, where the Mg2+ concentration is too low, there either is no product formed (lanes 1-5) or very little product formed (lane 6). Lanes 7 - 11 represent optimal concentrations of Mg2+ for this PCR experiment as indicated by the presence of the 2098 bp amplicon product. (b) An uncharacterized mycobacteriophage genomic DNA template was used to amplify a 566 bp amplicon. Lanes 1 - 4, the Mg2+ concentration is too low, as indicated by the absence of product. Lanes 5 - 11 represent optimal concentrations of Mg2+ for this PCR as indicated by the presence of the 566 kb amplicon product. (c) . S. cerevisiae Yeast genomic DNA was used as a template to amplify a 2098 bp GAL3 gene as indicated in panel a. However, the annealing temperature was reduced from 61 °C to 58 °C, resulting in a non-specific PCR bands with variable lengths producing a smearing effect on the agarose gel. Lanes 1 - 4, where the Mg2+ concentration is too low, there is no product formed. Lanes 5 - 8 represent optimal concentrations of Mg2+ for this PCR as seen by the presence of a smear and band around the 2098 kb amplicon product size. Lanes 9 - 11 are indicative of excessively stringent conditions with no product formed. (a-c) Lanes 12 is a negative control that did not contain any template DNA. Lane M (marker) was loaded with NEB 1kb Ladder.

Figure 4. Sterile tubes used for PCR. (1.) 1.8 ml tube (2.) 0.2 ml individual thin walled PCR tube, (3.) 0.2 ml strip thin walled PCR tubes and caps.

Figure 5. Thermal cycler. Closed thermal cycler left image. Right image contains 0.2 ml thin walled PCR tubes placed in the heating block of an open thermal cycler.
PCR has become an indispensible tool in the biological science arsenal. PCR has altered the course of science allowing biologists to yield power over genomes, and make hybrid genes with novel functions, allowing specific and accurate clinical testing, gaining insights into genomes and diversity, as well as simply cloning genes for further biochemical analysis. PCR application is limited only by the imagination of the scientist that wields its power. There are many books and papers that describe new specialized uses of PCR, and many more will be developed over the next generation of biological science. However, regardless of the anticipated approaches, the fundamental framework has remained the same. PCR, in all its grandeur, is an in vitro application to generate large quantities of a specific segment of DNA.
Designing a PCR experiment requires thought and patience. The results shown in Figure 3 exemplify one of the major challenges when designing an optimization strategy for PCR. That is, as one parameter of PCR is changed, it may impact another. As an example, if the initial PCR was carried out at the sub-optimal annealing temperature (58°C) with an optimal Mg2+ concentration of 2.0 mM, then the result would produce a smear as seen in Figure 3c. An attempt to resolve the smear might involve setting up PCR conditions with reactions containing 2.0 mM MgCl2 and adjusting the annealing temperature to 61°C. However, as seen in Figure 3a, this would not yield any product. Consequently, it is advisable to titrate reagents, rather than adding one concentration to a single reaction, when troubleshooting spurious results. Also, the most common adjustments that are required for optimizing a PCR experiment are to change the Mg2+ concentration and to correct the annealing temperatures. However, if these changes do not minimize or abrogate aberrant results, titration of additives and /or changing the cycling condition protocols as described in Tables 2-6 may alleviate the problem. If all else fails, redesign the primers and try, try again.
I have nothing to disclose.
Special thanks to Kris Reddi at UCLA for setting up reagents and pouring gels and to Erin Sanders at UCLA for inspiration, guidance, and support and proofreading the manuscript. I would also like to thanks Giancarlo Costaguta and Gregory S. Payne for supplying the yeast genomic DNA and primers to amplify the GAL3 gene. I would also like to thank Bhairav Shah for taking pictures of the lab equipment and reagents used to make figures 2 - 4. Funding for this project was provided by HHMI (HHMI Grant No. 52006944).
| Taq Polymeras | Sigma-Aldrich | D4545-25UN | |
| dNTPs | Qiagen | 201225 | |
| 0.2 ml Thin Wall Tubes PCR tubes | Bio-Rad | 223-9469 | |
| 0.2 ml Thin Wall Tube caps | Bio-Rad | 223-9472 | |
| EDTA disodium salt dihydrate | Sigma-Aldrich | E5134 | |
| Trizma-HCl | Sigma-Aldrich | T-3253 | |
| Custom Phage Primer | Invitrogen | 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG | |
| Custom Phage Primer | Invitrogen | 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT | |
| Custom Yeast Primer | Integrated DNA Technologies | SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG | |
| Custom Yeast Primer | Integrated DNA Technologies | Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG | |
| Thermal Cycler | Bio-Rad | 170-9703 | My Cycler |
| Agarose | ISC BioExpress | E-3120-500 | |
| Gel electrophoresis | Hoeffer Scientific Instruments | Model HE33 | |
| 1 kb DNA Ladder | New England Biolabs | N3232S | |
| Bio Rad Power Pack | Bio-Rad | 164-5050 | PowerPac Basic |
| Gel Doc system | Fotodyne Incorporated | FOTO/Analyst Investigator FX Workstation |