An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.
Method Article
An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.
Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.
1. Primer Design
2. High-throughput PCR Amplification and Purification
3. Competent Cells Preparation
4. Cell Transformation and Antibiotic Selection
5. Mutant Confirmation and Storage
Access restricted. Please log in or start a trial to view this content.
After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...
Access restricted. Please log in or start a trial to view this content.
To minimize the possible polar effects of the replacement of one targeted gene with exogenous antibiotics gene on neighboring genes, two steps are taken while initial primer designing. For most of deleted genes, the primers R1 and F3 are designed to delete the coding region from 6 bp following the start codon to 30 bp prior to the stop codon. The last 30 base pairs are retained to protect potential ribosomal binding site used by the adjacent downstream gene. The retained region between two neighboring genes is extended t...
Access restricted. Please log in or start a trial to view this content.
No conflicts of interest declared.
This work was supported by grants R01DE018138 from the National Institutes of Health (PX) and in part, by Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144602-3 (PX). We thank Drs. Lei Chen, Yuetan Dou and Xiaojing Wang for assisting with the construction of genome wide mutants. We also thank the DNA Core Facility at Virginia Commonwealth University for DNA sequencing.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Primer F2 | Integrated DNA Technologies | TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT | |
| Primer R2 | ibid | CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT | |
| Primer F2p | ibid | GATAAACCCAGCGAACCATTTGA | |
| Primer P1 | ibid | GCTTATATACCTTAGCAGGAGACA | |
| Primer P2 | ibid | GTATGACATTGCCTTCTGCGTCC | |
| Primer 5' end_R1_seq | ibid | GCCATTTATTCCTCCTAGTTAGTCA | |
| Primer 5' end_F3_seq | ibid | GTTTTAGTACCTGGAGGGAATAATG | |
| Primer 5' end_R1p_seq | ibid | CCTCAAATGGTTCGCTGGGTTTATC | |
| CSP | Synprep | Sequence:NH2-DLRGVPNPWGWIFGR-COOH | |
| DNA Polymerase | Invitrogen | 11304-102 | Platinum Taq DNA Polymerase High Fidelity |
| EcoRI | New England Biolabs Inc | R0101S | Restriction enzyme |
| Agar | American Bioanalytical | AB01185 | |
| Agarose | Promega | V3125 | |
| BHI | BD Biosciences | 237500 | Brain Heart Infusion |
| Horse serum | Fisher Scientific | SH3007403 | Horse serum |
| Km | Fisher Scientific | BP906-5 | Kanamycin |
| TH broth | BD Biosciences | 249240 | Todd Hewitt broth |
| PureLink 96 | Invitrogen | K310096 | PureLink 96 PCR purification kit |
| QIAquick | Qiagen | 28106 | QIAquick PCR purification kit |
| Filter | Corning | 431117 | 0.22 μm polystyrene filter |
| Anoxomat System | Mart Microbiology b.v. | Anoxomat Mark II | |
| Benchtop centrifuge | Thermo Scientific | 75004377 | Sorvall Legend RT Plus microplate rotor |
| Gel Documentation | UVP LLC | BioDoc-It 210 | |
| Incubator | Fisher Scientific | 11-690-625D | Isotemp |
| Labnet's Gel XL | Labnet | E0160 | Labnet's Gel XL |
| Microcentrifuge | Eppendorf | 22621408 | Microcentrifuge 5415 R |
| Multichannel pipettes | Thermo Scientfic | 4661040, 4661020 | Finnpipette F1 |
| Thermal Cycler | Applied Biosystems Inc. | N805-0200 | GeneAmp PCR system 9700 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission