In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Summary

This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

Abstract

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter implantation. The technical limitation of this surgical technique lies in the finesse of the hands. The injection is rapid, especially for a trained experimenter, and since tissue disruption with this technique is minimal, repeated injections are possible; moreover immune reaction to foreign tools (e.g. catheter) does not occur, thereby giving a better and more specific read out of spinal cord modulation. Since the application of the substance is largely limited to the target region of the spinal cord, drugs do not need to be applied in large dosages, and more importantly unwanted effects on other tissue, as observed with a systemic delivery, could be circumvented^1,2. Moreover, we combine this technique with in vivo transfection of nucleic acid with the help of polyethylenimine (PEI) reagent³, which provides tremendous versatility for studying spinal functions via delivery of pharmacological agents as well as gene, RNA, and protein modulators.

Introduction

The spinal cord is a very important center in a variety of key biological processes and physiological functions, including processing and transmission of painful (nociceptive) inputs^4-7. Various experimental techniques have been developed to facilitate pharmacological modulation of the spinal cord, such as chronic implantation of intrathecal catheters⁸, spinal cord microinjection, and intrathecal needle injection⁹. Each technique has its own advantages and drawbacks, and depending on the experiment paradigm one technique might be more suitable than the others. Whereas chronic implantation of intrathecal catheters is readily feasible in....

Protocol

All animal usage procedures were in accordance with ethical guidelines laid down by the local governing body (Regierungspräsidium Karlsruhe, Karlsruhe, Germany).

1. Preparation of siRNA/PEI Complex

The siRNA/PEI complex solution is prepared using manufacturer's directions as follows:

1. Solution A: Dilute the desired amount of siRNA with sterile water (if necessary) up to a quarter of the end volume and dilute this further with 10% glucose solution up to half of end volume. Vortex gently or mix by pipetting up and down. The optimal amount of siRNA needs to be determined empirically but 1
   ....

Results

In order to illustrate a successful injection, we performed this technique using Fast Green FCF dye in adult C57Bl6 mice (8-10 weeks of age). The animal was allowed to recover for a few minutes after the injection to provide enough time for the dye to spread and then killed with an overdose of CO₂. Subsequently, the vertebrate column was dissected and the spinal cord was exposed. The blue puncta corresponding to the diffused dye, marked the injection site. No sign of injury to the spinal cord could be seen, co.......

Discussion

Thus, the above-described technique of intrathecal needle injections is efficacious, fast, specifically-localized, and nondestructive. Technically, the most critical aspect of this procedure is the point of needle insertion into the groove. It is crucial that this procedure is done with very calm hands and patience. Like many surgical procedures, training improves the rate of successful injection. This is also important because during an actual experiment, this technique does not provide an obvious indicator to directly .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
In Vivo-jetPEI	Polyplus	201-10G
WAVE1 siRNA	Santa Cruz	sc-36832
Control siRNA-A	Santa Cruz	sc-37007
Anti-ß-Tubulin III antibody	Sigma	T2200
Anti-WAVE1 antibody	R&D Systems	AF5514
Fast green dye	Sigma	F-7252
Isoflurane	Baxter
Isoflurane setup	Dräger Lübeck
Shaver	Wella
Hamilton syringe Gastight 1702	Hamilton
30 G 1/2 in 13 mm Needle	BD Microlance	304000
Microscope Leica MS5	Leica
WAVE1 forward primer for qRT-PCR	Sigma		cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR	Sigma		cttttcaccaacggcatctt
FastStart Essential DNA Green Master	Roche	6402712001