Studying DNA Looping by Single-Molecule FRET

Summary

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Abstract

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Introduction

Understanding the mechanical properties of dsDNA is of fundamental importance in basic sciences and engineering applications. The structure of dsDNA is more complicated than a straight helical ladder because roll, tilt, and twist angles between successive base pairs can vary with sequence. Thermal fluctuations can cause dsDNA to undergo diverse modes of conformational fluctuations such as bending, twisting and stretching. Transitions such as melting and kinking can also occur in extreme conditions.

Among these motions, dsDNA bending has the most noticeable biological impact¹. dsDNA bending is associated with gene repression or ac....

Protocol

1. dsDNA Sample Preparation

1. Design globally curved DNAs by repeating a 10-mer sequence. For example, 5’-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCCX)₇ - TTTCATTCGAGCTCGTTGTTG-3’ is a 186-bp curved DNA where X is a random extra base and the sequence flanking the repeating 10-mer sequence are adapter sequences.
   NOTE: In this example two 10-mers with opposite preferences to nucleosome formation based on a large-scale nucleosome occupancy study by Kaplan et al.¹⁵ were chosen. Since the helical repeat of dsDNA is close to 10 bp, any net deflection of the helical axis of the 10-mer will accumul....

Results

DNA molecules used for the looping study consist of a duplex region of variable sequence and length and single-stranded overhangs that are complementary to each other. The overhangs, which are 7-base long, can anneal to each other to capture the looped state. Each overhang contains either Cy3 or Cy5 that is linked in the DNA backbone through amidite chemistry. The Cy5-overhang is also linked with biotin-TEG (15-atom Tetra-Ethylene Glycol spacer) for surface immobilization (see Figure 4A). All these modif.......

Discussion

A simple single-molecule assay based on FRET was used to study looping kinetics of DNAs of different intrinsic shapes. Curved DNAs can be prepared by repeating a 10-mer sequence in phase with the helical period of 10.5 bp, and their curvatures can be estimated using PAGE. These dsDNAs are designed with sticky ends to allow transient loop stabilization. We extracted the looping rate from the exponential rise in the number of looped molecules over time. The annealing rate constant between the disconnected sticky end segmen.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Small DNA FRAG Extract Kit-100PR	VWR	97060-558
Acrylamide 40% solution 500 ml	VWR	97064-522
Bis-acrylamide 2% (w/v) solution 500 ml	VWR	97063-948
GeneRuler 100 bp DNA Ladder, 100-1,000 bp	Fermentas	SM0241
Mini Vertical PAGE System	VWR	89032-300
Syringe filter 0.2 μm CS50	VWR	A2666
Trolox	Sigma-Aldrich	238813-1G	triplet state quencher
Protocatechuic acid (PCA)	Sigma-Aldrich	08992-50MG	oxygen scavenging system
Protocatechuate 3,4-Dioxygenase (PCD)	Sigma-Aldrich	P8279-25UN	oxygen scavenging system
mPEG-silane, MW 2,000 1 g	Laysan Bio	MPEG-SIL-2000-1g
Biotin-PEG-Silane, MW 3,400	Laysan Bio	Biotin-PEG-SIL-3400-1g
Avidin, NeutrAvidin Biotin-binding Protein	Invitrogen	A2666
Phusion Hot Start High-Fidelity DNA Polymerase	New England Biolabs	F-540L
Gel/PCR DNA Fragments Extraction Kit	IBI Scientific	IB47020
Premium plain glass microscope slides	Fisher Scientific	12-544-1
VWR micro cover glass, rectangular, no. 1	VWR	48404-456
Fisher Scientific Isotemp 1006S Recirculating Chiller/Heater	Fisher Scientific		temperature control
Objective Cooling Collar	Bioptechs	150303	temperature control
KMI53 Biological Micrometer Measuring Stage	Semprex	KMI53
High Performance DPSS Laser 532 nm 50 mW	Edmund optics	NT66-968	Cy3 excitation
CUBE Fiber Pigtailed 640 nm, 30 mW, Fiber, FC/APC Connector	Coherent	1139604	Cy5 excitation
650 nm BrightLine Dichroic Beamsplitter	Semrock	FF650-Di01-25x36	splitting dichroic
LaserMUX Beam Combiner, reflects 514.5, 532, & 543.5 nm lasers, 25 mm	Semrock	LM01-552-25	combining dichroic
Brightline Fluorescence Filter 593/40	Semrock	FF01-593/40-25	Cy3 emission filter
635 nm EdgeBasic LWP longpass Filter, 25 mm	Semrock	BLP01-635R-25	Cy5 emission filter
EMCCD iXon+	Andor Technology	DU-897E-CS0-#BV
IX51 inverted microscope frame	Olympus
Objective UApo N 100X/1.49 Oil TIRF	Olympus
Immersion oil type-F for fluorescence microscopy	Olympus	IMMOIL-F30CC
2 mm Diameter 45° Rod Lens Aluminum Coated	Edmund optics	54-092	miniature mirror
1/4" Travel Single-Axis Translation Stage	Thorlabs	MS-1	translation of miniature mirror
Ø1" Achromatic Doublet, ARC: 400-700 nm, f=200 mm	Thorlabs	AC254-200-A	focusing lens
Adjustable Mechanical Slit	Thorlabs	VA100
Dielectric Mirror	Thorlabs	BB1-E02
Ø1" Achromatic Doublet, f = 100 mm	Thorlabs	AC254-100-A	relay lens
Lens Mount for Ø1" Optics	Thorlabs	LMR1
Dichroic Filter Mount	Thorlabs	FFM1
Fixed Cage Cube Platform	Thorlabs	B3C
Kinematic Mount for Ø1" Optics	Thorlabs	KM100
N-BK7 Plano-Convex Lens, Ø1", f = 40 mm	Thorlabs	LA1422-A	collimating lens
N-BK7 Plano-Convex Lense, Ø6.0 mm, f = 15 mm	Thorlabs	LA1222-A	telescope lens
N-BK7 Plano-Convex Lense, Ø6.0 mm, f = 150 mm	Thorlabs	LA1433-A	telescope lens