Method Article

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

DOI:

10.3791/52655

May 6th, 2015

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we present a protocol to generate a proof-of-principle divalent adenovirus type 5 (Ad5) vector Ad5/H5-HVR1-KWAS-HVR5-His6 by utilizing the Antigen Capsid-Incorporation strategy. This vector was demonstrated to exhibit qualitative fitness, the capability to escape Ad5-positive sera in vitro, and the antigenicity as well as immunogenicity to the incorporated antigens.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these traditionally modified Ad5 vectors in clinical trials could be primarily correlated with Ad5 pre-existing immunity (PEI) among the majority of the population. To promote Ad5-vectored vaccine development by solving the concern of Ad5 PEI, the innovative Antigen Capsid-Incorporation strategy has been employed. By merit of this strategy, Ad5-vectored we first constructed the hexon shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S by subcloning the hypervariable region (HVR) 1 of hexon into a previously constructed shuttle plasmid HVR5-His6/pH5S, which had His6 tag incorporated into the HVR5. This HVR1 DNA fragment containing a HIV epitope ELDKWAS was synthesized. HVR1-KWAS-HVR5-His6/pH5S was then linearized and co-transformed with linearized backbone plasmid pAd5/∆H5 (GL) , for homologous recombination. This recombined plasmid pAd5/H5-HVR1-KWAS-HVR5-His6 was transfected into cells to generate the viral vector Ad5/H5-HVR1-KWAS-HVR5-His6. This vector was validated to have qualitative fitness indicated by viral physical titer (VP/ml), infectious titer (IP/ml) and corresponding VP/IP ratio. Both the HIV epitope and His6 tag were surface-exposed on the Ad5 capsid, and retained epitope-specific antigenicity of their own. A neutralization assay indicated the ability of this divalent vector to circumvent neutralization by Ad5-positive sera in vitro. Mice immunization demonstrated the generation of robust humoral immunity specific to the HIV epitope and His6. This proof-of-principle study suggested that the protocol associated with the Antigen Capsid-Incorporation strategy could be feasibly utilized for the generation of Ad5-vectored vaccines by modifying different capsid proteins. This protocol could even be further modified for the generation of rare-serotype adenovirus-vectored vaccines.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Human adenovirus (Ad) is a medium-sized, non-enveloped virus with an icosahedral nucleocapsid containing a double stranded DNA genome. Ad belongs to the Adenoviridae family, with a classification into seven groups (A through G). Each group contains virus of different serotypes. Of which, adenovirus serotype 5 (Ad5) from group C has been the most extensively studied and the most widely applied for vectored approaches like gene therapy and vaccinations.

The traditional transgene strategy has been developed and applied for Ad5 modifications, which is characterized by the displacement of the virus early genes with a gene-of-interest, and the focused expression of the gene-of-interest in a host. Examples are the construction of pENV9/Ad5hr∆E3 by replacing early gene 3 (E3) with rev gene of Simian Immunodeficiency Virus1, the construction of AdCMVGag by replacing early gene 1 (E1) with the gag gene of Human Immunodeficiency Virus (HIV)2, and the construction of AdlacZ by replacing E1 with lacZ gene3. The broad application of the traditional transgene strategy on Ad5 depends on the following merits: the wide range of hosts for Ad5, the feasible gene engineering on virus and virus propagation, the large accommodation of foreign gene insert and the safety of Ad54,5. However, the reduced efficacies of Ad5-vectored clinical therapies by use of this strategy has been a major bottleneck, which has been mapped to be primarily associated with Ad5 PEI, since Ad5 is so prevalent among the majority of children and adults4,6.

To overcome the major bottleneck of Ad5, the primary objective is to develop an alternative strategy circumventing Ad5 PEI. Innate immunity7, adaptive immunity such as neutralizing antibodies (NAbs)8-10 and CD8+ T cell responses10 against Ad5 have been shown to contribute to Ad5 PEI, with Ad5 NAbs appearing to play the dominant role in the contributions to Ad5 PEI10,11. Moreover, Ad5 NAbs target epitopes located in capsid proteins, including the major protein hexon, fiber and penton base. Of which, hexon is the major target of Ad5 NAbs8,11-13. Based on these findings, an innovative Antigen Capsid-Incorporation strategy has been introduced. This novel strategy highlights the replacement or incorporation of proteins-of-interest on Ad5 capsid proteins, which shifts or masks the Ad5 neutralizing epitopes, leading to the decreased recognition by the NAbs and efficient Ad5 vector administrations. It is noteworthy that this strategy is competitive because it can also help hosts elicit robust humoral immunity and potent cellular immunity by directly presenting antigens-of-interest to the immune system4,14,15. Based on this strategy, the molecular cloning and recombinant Ad viral vector rescue can be structurally divided into four main steps: (a) the preparation of gene-of-interest fragment by either polymerase chain reaction (PCR) or synthesis; (b) the ligation of gene fragment into a shuttle plasmid that contains the gene-of-interest fragment and homologous arms to an adenovirus backbone; (c) the homologous recombination by co-transforming the shuttle plasmid containing the gene-of-interest fragment with the linearized backbone plasmid pAd5/∆H5 (GL)16; (d) the transfection of linearized recombinant adenoviral plasmid to rescue the recombinant Ad vector incorporated with antigens-of-interest.

Our group and some others have extended this alternative Ad incorporation strategy for Ad vectored vaccine development against different infectious pathogens. We reported the generation of a recombinant Ad vector Ad-HVR1-lgs-His6-V3 by incorporating a His-tagged HIV-1 antigen V3 into the HVR1 locale of Ad5 hexon (hexon5). This generated vector triggered strong humoral immune response specific to the V3 epitope4. We also reported the development of Ad5/HVR2-MPER-L15∆E1 by incorporating HIV-1 membrane proximal ectodomain region (MPER) into the HVR2 locale of hexon52. In addition, Dr. Zhou’s group has used the benefits of this Ad incorporation strategy to develop Ad serotype 3 (Ad3) vectored vaccines, i.e., the generation of viral vector R1SP70A3 by incorporating a neutralizing epitope SP70 of Enterovirus 71 into the HVR1 of Ad3 hexon (hexon3). R1SP70A3 generated strong NAbs and IFN-γ production specific to the epitope SP70, which lead to the high rate of protection against Enterovirus 71 challenge15.

For the purpose of technical reference, our study took advantage of the qualitative Antigen Capsid-Incorporation strategy to focus on the generation of a divalent Ad5 vector Ad5/H5-HVR1-KWAS-HVR5-His6 by incorporating an HIV-1 antigen into HVR1 and a His tag into HVR5 of hexon5. The generated viral vector was also immunologically evaluated. The Antigen Capsid-Incorporation strategy could be utilized towards the development of Ad5-vectored vaccination approaches against different infectious diseases.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The University of Alabama at Birmingham Institutional Animal Use and Care Committee approved the use of mice as described herein under the approved protocol number 101109272.

1. Genetic Construction of a Modified Plasmid pAd5/H5-HVR1-KWAS-HVR5-His 6 with the Antigen Capsid-Incorporation Strategy

  1. Construction of the shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S
    1. Order a plasmid containing the synthesized DNA sequence HVR1-KWAS between the restriction enzyme sites AgeI to AccI of hexon5 gene.
    2. Digest 6 µg of the synthesized fragment (HVR1-KWAS) with the enzymes AgeI (6 units) and AccI (6 units) for 3 hrs at 37 °C. Resolve the digested fragment in a 2% agarose gel by electrophoresis, and purify the fragment with a DNA gel extraction kit according to the manufacturer’s protocol.
    3. Based on the molar ratio of insert to vector at 3 : 1, use T4 DNA ligase and ligase buffer to ligate 12 ng of the fragment (HVR1-KWAS) into 100 ng of a previously constructed shuttle plasmid HVR5-His6/pH5S17 in a 10 µl volume at RT for 2 hr, via the sites of AgeI and AccI.
    4. Transform 1 µl out of 10 µl of the ligation product into 50 µl of electrocompetent DH5α cells in an electroporator (at 1800 V). Add 950 µl of SOC medium to the transformed DH5α cells and incubate the mixture for 1 hr at 37 °C, with 300 rpm. Spread 100-200 µl of the 1 ml mixture on the Luria-Bertani (LB) agar containing kanamycin and incubate O/N at 37 °C.
      1. To screen ~ 10 colonies by PCR targeting the fragment HVR1-KWAS, mix the forward primer (TATGTGTGTCATGTATGCGT), reverse primer (GGAGGCCCACTTGTCCAGCTC) and a single DH5α colony into a PCR master mix solution (according to manufacturer’s protocol). Run samples on a thermocycler by referring to the manual provided with the PCR master mix solution.
      2. Use the forward primer (TATGTGTGTCATGTATGCGT) to sequence the fragment HVR1-KWAS in the clones screened in the section 1.1.4.1.
  2. Construction of the plasmid pAd5/H5-HVR1-KWAS-HVR5-His6
    1. Digest 6 µg of HVR1-KWAS-HVR5-His6/pH5S with enzymes EcoRI (6 units) and PmeI (6 units) for 3 hrs at 37 °C, and purify the fragment containing homologous recombination arms and the dual modified hexon5 gene, as stated in step 1.1.2. Linearize the backbone plasmid pAd5/∆H5 (GL)16 with SwaI.
    2. Co-transform 100 ng of the target fragment from the shuttle plasmid and 100 ng of the linearized pAd5/∆H5 (GL) backbone into 50 µl of electrocompetent BJ5183 cells for the homologous recombination in an electroporator (at 1800 V). Add 950 µl of SOC medium to the transformed cells and incubate the mixture for 1 hr at 37 °C, 300 rpm. Spread 100 - 200 µl of the 1 ml mixture on the LB agar containing kanamycin (final 50 µg/ml) for O/N incubation at 37 °C.
      1. Pick ~10 tiny colonies into 3 ml liquid LB containing kanamycin (final 50 µg/ml) for O/N incubation at a shaker (250 rpm, 37°C). Extract plasmids from the culture. Use PCR analysis to screen the 10 colonies by targeting the fragment HVR1-KWAS, as illustrated in step 1.1.4.1.
      2. To screen the same colonies by PCR analysis targeting the pIX fragment of the backbone genome, mix the forward primer (AGCTGTTGGATCTGCGCCAGCAGGTT), reverse primer (CCAAACAGAGTCTGGTTTTTTATTTAT) and a single BJ5183 colony into a PCR master mix solution (according to manufacturer’s protocol). Run samples on a thermocycler by referring to the manual provided with the PCR master mix solution.
      3. Designate the PCR double-positive colonies as pAd5/H5-HVR1-KWAS-HVR5-His6.
    3. Transform 100 ng of the plasmid pAd5/H5-HVR1-KWAS-HVR5-His6 into DH5α cells as illustrated in step 1.1.4.
      1. Use PCR analysis to screen ~ 10 colonies by targeting the fragment HVR1-KWAS, as illustrated in step 1.1.4.1.
      2. Use PCR analysis to screen the same colonies by targeting the pIX fragment of the backbone genome, as illustrated in step 1.2.2.2.
      3. Use the forward primer (TATGTGTGTCATGTATGCGT) to sequence the fragment HVR1-KWAS in pAd5/H5-HVR1-KWAS-HVR5-His6.

2. Preparation of Modified Ad5 Viral Vector Ad5/H5-HVR1-KWAS-HVR5-His 6

  1. Constitute the complete medium by adding FBS (final 10%), 100X Non-Essential Amino Acids (final 0.1 mM), 200 mM L-glutamine (final 2 mM) and penicillin/streptomycin solution (final 1%) into DMEM with high glucose. Maintain human embryonic kidney (HEK293) cells in complete medium in a culture incubator (37 °C and 5% CO2 under 85% humidified conditions).
  2. Rescue of viral vector Ad5/H5-HVR1-KWAS-HVR5-His6
    1. Seed 3.0 x 106 of the HEK293 cells in one T-25 flask containing 5 ml of complete medium and culture O/N to achieve a monolayer with 80% confluence.
    2. Linearize 15 µg of pAd5/H5-HVR1-KWAS-HVR5-His6 in a 100 µl volume with restriction enzyme PacI (15 units) at 37 °C for 3 hrs.
      1. Extract linearized pAd5/H5-HVR1-KWAS-HVR5-His6 by centrifuging the reaction twice (10,000 x g for 1 min) with an equal volume of phenol:chloroform:isoamyl alcohol (ratio at 25 : 24 : 1) in a fume hood, and by sequential centrifugation (10,000 x g for 10 min) with a mixed solution (300 µl of 100% ethanol and 10 µl of sodium acetate) and 700 µl of 70% ethanol. Discard supernatant at each centrifugation step.
    3. Resuspend the purified plasmid in ~ 40 µl of distilled water or Tris-EDTA (TE) buffer. Quantitate the plasmid DNA by measuring the optical density (OD) at 260 nm.
    4. Transfect 3 µg of the linearized plasmid with commercial liposomal transfection reagent in the T-25 flask, according to the manufacturer’s manual. Change the transfection medium with complete medium at 6 hrs post-transfection and subsequent incubation in the culture incubator. Maintain transfected cells by replacing complete medium every two to three days, until individual viral plaques form.
    5. When plaques develop to full cytopathic effect (CPE), scrape the remaining cells off the flask in a sterile hood, and harvest cell lysate by centrifuging medium at 300 x g for 10 min at 4 °C. Suspend the cell pellet in ~1 ml of medium containing 2% FBS, and break cells by freeze-thawing four times. Collect the supernatant containing rescued virus after centrifuging lysate at 10,000 x g for 10 min at 4 °C.
  3. Large scale propagation of the viral vector Ad5/H5-HVR1-KWAS-HVR5-His6
    1. Propagate the virus in a T-75 flask containing HEK293 cells in the sterile hood by infecting with 1/3 to full lysate from the T-25 flask. Allow full CPE to develop within two to three days in the culture incubator. Harvest the lysate supernatant as stated in step 2.2.5.
    2. Propagate the virus in one to three T-175 flasks in the sterile hood by infecting with 1/2 to full lysate from the T-75 flask, depending on the virus propagation conditions. Allow full CPE to develop within two to three days in the culture incubator. Harvest the lysate supernatant as stated in step 2.2.5.
    3. Propagate the virus in one dozen or more T-175 flasks in the sterile hood by infecting with 1/2 to full lysate from the previous T-175 flask(s). Determine the amount of flask usage based on the virus propagation conditions and the amount of virus in need. Harvest the lysate supernatant as stated in step 2.2.5 when full CPE occurs within two to three days in the culture incubator.
  4. Purification of Ad5/H5-HVR1-KWAS-HVR5-His6 by caesium chloride
    1. Prepare two densities of CsCl solutions in 5 mM HEPES: 1.33 g/ml and 1.45 g/ml, while avoiding contact with CsCl.
    2. Load 4 ml of CsCl (1.33 g/ml) in a sterile ultracentrifuge tube, and gently load 4 ml of CsCl (1.45 g/ml) against bottom of the tube. Load 4 ml of lysate supernatant slowly on top of the gradients in the sterile hood.
    3. Centrifuge the tube at 110,000 x g for 3 hrs at 4 °C to separate the mature/lower virus band from the defective/higher virus band. Collect the lower band using a 3 ml syringe armed with a 33 G needle and dilute the band with 5 mM HEPES to a 4 ml volume in the sterile hood.
    4. Load another tube with two densities of CsCl solutions and the diluted band of virus as described in step 2.4.2. Centrifuge the tube at 110,000 x g O/N at 4 °C. Collect the viral band as described in step 2.4.3.
    5. Inject the collected virus solution in a dialysis cassette by a 3 ml syringe armed with a 33 G needle in the sterile hood.
    6. Place the cassette in 700 ml of 1x dialysis buffer (1 L recipe: 100 ml of 10x PBS, 100 ml of 100% glycerol and 800 ml of distilled water; filter the buffer through a 0.22 µm filter) and replace the dialysis buffer every 3 hrs for 4 times. Aspirate out dialyzed virus solution using needled syringe.

3. Validation of the Rescued Viral Vector

  1. Viral Vector Titrations
    1. For the virus physical titer, dilute both virus and dialysis buffer (background control) at 1 : 10 and 1 : 20 in virus lysis buffer (10% SDS in Tris-EDTA) in small tubes, and incubate all tubes at 56 °C for 10 min.
    2. Turn on a biophotometer and set the mode of absorbance at OD 260 nm. Use the diluted dialysis buffer (1 : 10) to balance the background signal by clicking the “blank” bottom. Type "10 + 90" in the biophotometer screen, and read the signal of the diluted virus (1 : 10).
    3. Read the signal of the diluted virus (1 : 20) by following the method in step 3.1.2, but instead type "5 + 95" in the biophotometer screen. Multiply the two virus readout numbers by 1.1x1012 and calculate the average titer with a unit as VP/ml, based on the two individual titers from the two dilutions.
    4. For the virus infectious titer (IP/ml), use the KARBER statistical TCID50 method14 to determine the infection depth on HEK293 cells at 10 days post infection (d.p.i.)
  2. Evaluation of antigenic exposure display on the viral vector
    1. Coat the viral vector in an ELISA plate and proceed with the rest of steps in a standard ELISA method14. Use human anti-gp41 (2F5) monoclonal antibody (mAb) and mouse anti-His tag mAb for the detection of corresponding incorporated antigens14.
    2. Resolve the viral vector in a denatured protein gel electrophoresis (SDS-PAGE) and proceed with the rest of steps in a standard western-blot method14. Use human anti-gp41 (2F5) monoclonal antibody (mAb) and mouse anti-His tag mAb for the detection of corresponding incorporated antigens14.
  3. In vitro evaluation of the vector on the ability to bypass Ad5-positve sera
    1. Maintain HeLa cells in complete medium in the culture incubator (37 °C and 5% CO2 under 85% humidified conditions). Constitute the complete medium by adding FBS (final 10%), 200 mM L-glutamine (final 2 mM) and penicillin/streptomycin solution (final 1%) into Minimum Essential Medium Eagle (MEME).
    2. Seed HeLa cells in 6-well plates at 1x106 cells/well, and incubate the plates in the culture incubator (37 °C and 5% CO2 under 85% humidified conditions) for 2 hrs. Incubate Ad5-positive sera (0.1 µl or 0 µl) with 5 IP/cell of viral vector (Ad5 or Ad5/H5-HVR1-KWAS-HVR5-His6) in the culture incubator for 1 hr before adding the mixtures onto the 6-well plates containing cells.
    3. At 24 hrs post infection (h.p.i.), rinse cells once with PBS and lyse cells in 0.5 ml of lysis buffer. Centrifuge at 15,000 x g for 5 min and collect the supernatant. Mix 20 µl of the supernatant with 100 µl of luciferase substrate for the luciferase signal reading, since viruses contain the luciferase gene.

4. Immunological Evaluation of the Rescued Viral Vector

  1. Prepare two immunization groups: Ad5 and Ad5/H5-HVR1-KWAS-HVR5-His6.
    1. Inject mice (n = 8/group) intramuscularly with viruses at 1x1010 VP/mouse, in a homologous “prime-boost” immunization regimen, with an interval of 2 weeks.
    2. At 2 weeks post every injection, bleed mice without anesthesia by cheek bleeding with animal lancets (5 mm tip length) to collect blood in 1.5 ml tubes.
  2. Mix the blood in the tubes by inverting up and down, and incubate the blood at RT for 30 min. Spin the tubes at 10,000 x g for 5 min at 4 °C and transfer sera (top layer) to new 1.5 ml tubes.
    1. Spin the new tubes at 10,000 x g for 5 min at 4 °C and transfer sera to newly marked 1.5 ml tubes for storage at -80 °C.
  3. Evaluation of antigen-specific humoral immunity by sera-based ELISA
    1. Dilute His peptide (stock at 1 mM) and HIV-1 peptide (stock at 1 mM) separately in 100.
    2. mM carbonate buffer (pH 9.5) to achieve the peptide coating concentration at 10 µM. Coat the ELISA plates with the diluted peptides separately by adding 100 µl per well and incubating the plates O/N at 4 °C.
    3. Wash the plates with PBST for four times at 200 µl/well and block for 1 hr in 5% BSA in PBST. Apply mice sera to the plates at 1 : 100 dilution in the blocking buffer, 100 µl/well. Incubate for 2 hr incubation at RT.
    4. Wash the plates with PBST for four times. Block the plates by incubating at RT for 30 min in the blocking buffer at 100 µl/well.
    5. Apply goat anti-mouse IgG-HRP (1:5000 in the blocking buffer) at 100 µl/well to both the plates coated with His peptide and HIV-1 peptide individually. Incubate for 2 hr at RT. Wash the plates with PBST.
    6. Read the plates at OD450 nm after incubating with HRP substrate for 30 min.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The Antigen Capsid-Incorporation strategy (Figure 1A) was utilized to generate the divalent Ad5 viral vector Ad5/H5-HVR1-KWAS-HVR5-His6. Firstly, the shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S was constructed by subcloning HVR1-KWAS fragment into the previous constructed shuttle plasmid HVR5-His6/pH5S17. Secondly, the plasmid pAd5/H5-HVR1-KWAS-HVR5-His614 was constructed by a homologous recombination between the fragment of “EcoRI-HVR1-KWAS-...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The application of the traditional transgene strategy on Ad5 modification for the development of vaccines has been diminished primarily due to the bottleneck associated with the Ad5 PEI4,6. This bottleneck can be partially diminished by application of the alternative Antigen Capsid-Incorporation strategy (Figure 1A), since this strategy can evade neutralization by Ad5 NAbs by replacing neutralizing epitopes of Ad5 with antigens-of-interest, and facilitate the generation of robust immunity to t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported in part by National Institutes of Health grants 5T32AI7493-20 and 5R01AI089337-03. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1x DPBSThermo ScientificSH30256.01for cell spliting 
10x DPBSThermo ScientificSH30378.02for dialysis buffer preparation
glycerolSIGMAG5516-1Lfor dialysis buffer preparation
SDSBIO-RAD161-0301for virus lysis buffer preparation
Fetal Bovine Serum (FBS)Thermo ScientificSH30910.03component of culture medium
100x Non-Essential Amino Acids Thermo ScientificSH30238.01component of culture medium
200 mM L-glutamineCellgro25-005-CIcomponent of culture medium
penicillin/streptomycin solution Cellgro30-002-CIcomponent of culture medium
DMEM with high glucoseThermo ScientificSH30081.01for HEK293 cell culture
Minimum Essential Medium EagleSIGMAM5650for HeLa cell culture
phenol:chloroform:isoamyl alcohol SIGMAP3803-100MLfor large size of DNA purification
cesium chloride Research Products International Corp.C68050for virus purificiation
HEPESCellgro25-060-CIfor CsCl solution preparation
HEK293ATCC51-0036for virus rescue and upscale
HeLaATCCCCL-2for neutralization assay
T-25 flaskThermo Scientific156367for cell culture 
T-75 flaskCORNING430641for cell culture 
T-175 flaskThermo Scientific159910for cell culture 
UltracentrifugeBECKMANNAfor virus purification
Ultracentrifuge tubeBECKMAN344059for virus purification
dialysis cassette Thermo Scientific66380for virus dialysis
ELISA plateThermo Scientific442404for ELISA
human anti-gp41 (2F5) mAbNIH AIDS Reagent Program1475for immunological assays
mouse anti-His tag mAbGenScriptA00186for immunological assays
SOC mediumCORNING46-003-CRfor transformation
PCR master mix solutionQIAGEN201445for PCR
Animal lancet (point length at 5 mm)MEDIpointfor mice bleeding 
BiophotometerEppendorffor virus physical titer titration

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Cheng, S. M., et al. Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant. Journal of virology. 66, 6721-6727 (1992).
  2. Matthews, Q. L., et al. HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach. PloS one. 5, e11815(2010).
  3. DeMatteo, R. P., et al. Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression. Journal of virology. 71, 5330-5335 (1997).
  4. Gu, L., et al. A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy. Virology journal. 11, 112(2014).
  5. Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. Viral Vectors for Vaccine Development. INTECH. , (2013).
  6. Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines. Expert review of vaccines. 8, 469-481 (2009).
  7. Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5. PloS one. 8, e61571(2013).
  8. Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection. Journal of virology. 86, 625-629 (2012).
  9. Zaiss, A. K., Machado, H. B., Herschman, H. R. The influence of innate and pre-existing immunity on adenovirus therapy. Journal of cellular biochemistry. 108, 778-790 (2009).
  10. Sumida, S. M., et al. Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors. Journal of virology. 78, 2666-2673 (2004).
  11. Sumida, S. M., et al. Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein. Journal of immunology. 174, 7179-7185 (2005).
  12. Bradley, R. R., et al. Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions. Journal of virology. 86, 1267-1272 (2012).
  13. Gahery-Segard, H., et al. Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity. Journal of virology. 72, 2388-2397 (1998).
  14. Gu, L., et al. Using multivalent adenoviral vectors for HIV vaccination. PloS one. 8, e60347(2013).
  15. Tian, X., et al. Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon. PloS one. 7, e41381(2012).
  16. Wu, H., et al. Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon. Journal of virology. 76, 12775-12782 (2002).
  17. Wu, H., et al. Identification of sites in adenovirus hexon for foreign peptide incorporation. Journal of virology. 79, 3382-3390 (2005).
  18. Qiu, H., et al. Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions. Journal of. 86, 7964-7975 (2012).
  19. Parker, C. E., et al. Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5. Journal of virology. 75, 10906-10911 (2001).
  20. Farrow, A. L., et al. Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection. PLoS neglected tropical diseases. 8, e3089(2014).
  21. Krause, A., et al. Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity. Journal of virology. 80, 5523-5530 (2006).
  22. Omori, N., et al. Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line. Neuroscience letters. 324, 145-148 (2002).
  23. Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX. Journal of virology. 76, 6893-6899 (2002).
  24. Xue, C., et al. Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus research. 183, 67-74 (2014).
  25. Tian, X., et al. Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon. Virus research. 160, 214-220 (2011).
  26. Kim, J. W., et al. An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer. PloS one. 8, e55533(2013).
  27. Vasconcelos, J. R., et al. Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine. PLoS pathogens. 8, e1002699(2012).
  28. Matthews, Q. L., et al. Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion. Molecular imaging. 5, 510-519 (2006).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Viral Vector ConstructionPlasmid Shuttle SystemHomologous RecombinationViral Titer AnalysisNeutralization AssayHIV Epitope DisplayHis6 Tag IncorporationCesium Chloride Purification

Related Articles