A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Summary

This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

Abstract

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated HF183 marker. The EntHF183 duplex dPCR (referred as EntHF183 dPCR hereon) assay uses the same primer and probe sequences as its published individual quantitative PCR (qPCR) counterparts. Likewise, the same water filtration and DNA extraction procedures as performed prior to qPCR are followed prior to running dPCR. However, the duplex dPCR assay has several advantages over the qPCR assays. Most important, the dPCR assay eliminates the need for running a standard curve and hence, the associated bias and variability, by direct quantification of its targets. In addition, while duplexing (i.e. simultaneous quantification) Enterococcus and HF183 in qPCR often leads to severe underestimation of the less abundant target in a sample, dPCR provides consistent quantification of both targets, whether quantified individually or simultaneously in the same reaction. The dPCR assay is also able to tolerate PCR inhibitor concentrations that are one to two orders of magnitude higher than those tolerated by qPCR. These advantages make the EntHF183 dPCR assay particularly attractive because it simultaneously provides accurate and repeatable information on both general and human-associated fecal contamination in environmental waters without the need to run two separate qPCR assays. Despite its advantages over qPCR, the upper quantification limit of the dPCR assay with currently available instrumentation is approximately four orders of magnitude lower than that achievable by qPCR. Consequently, dilution is needed for measurement of high concentrations of target organisms such as those typically observed following sewage spills.

Introduction

Quantitative PCR (qPCR) methods have been widely used for recreational water quality monitoring and microbial source tracking applications because they are faster, more flexible and specific compared to traditional culture-based methods. Consequently, qPCR is recommended for achieving rapid water monitoring results for general fecal indicators such as Enterococcus spp. in the revised USEPA recreational water quality criteria¹. Many qPCR assays have also been developed and validated for identifying sources of fecal contamination in environmental waters². Among these, the HF183 marker assays are among the most frequently used for identifying human-associated fecal contamination³.

However, qPCR results can often be biased because they rely on standard curves for quantification. qPCR quantifies unknown concentrations of target in samples by interpolating their quantification cycle (Cq) from a standard curve that describes a linear relationship between Cq and logarithmic quantity of a set of serially-diluted standards. Lack of reliable and consistent standard reference material can therefore greatly bias qPCR results. Studies showed that qPCR results differed by approximately half a log using standards from different vendors⁴ and by 2-fold using different batches of standards from the same vendor⁵.

Digital PCR (dPCR) technology quantifies an unknown sample by counting the frequency of positives in large numbers of miniature PCRs that are generated by partitioning a bulk qPCR into thousands or millions of uniform nanoliter or picoliter reactions⁶. It is referred as droplet digital PCR (i.e., this article) or chamber digital PCR, respectively, if the partitions are water-in-oil droplets (i.e., this article) or small chambers on a chip. A higher sample concentration will result in presence of target DNA (hence positive PCR) in a higher proportion of partitions, a relationship approximated by Poisson distribution. As such, the binary results (positive or negative PCR) are recorded and the frequency of positive droplets is used to calculate unknown sample concentrations directly via Poisson approximation, eliminating the need for a standard curve as in qPCR.

This binary nature of digital PCR quantification provides additional advantages over qPCR⁷. Because delayed amplification can still yield a positive PCR, dPCR quantification is more robust against inhibition that reduces amplification efficiency. Similarly, dPCR quantification is not affected by variability in Cq values as is qPCR, leading to higher precision of dPCR compared to qPCR^8-10.

In addition, the partitioning process ensures a very small amount of target DNA present in each droplet, effectively minimizing substrate competition (during amplification of different DNA targets) that are common obstacles to achieving duplexing (i.e. an assay simultaneously measures two DNA targets) in qPCR. As such, whether run in duplex or simplex (i.e. one target is measured in a single assay) dPCR produces nearly indistinguishable quantification of both targets^7,11.

The goal of the digital PCR assay (EntHF183 dPCR) described in this article is to obtain simultaneous direct quantification of the general fecal indicator Enterococcus spp. and the human-fecal associated HF183 marker with improved precision, reproducibility and robustness against inhibition compared to its qPCR counterparts. This assay has been successfully used for quantifying fecal contamination in environmental freshwater, marine water, and various fecal material⁷, but can also be applied to any other types of waters and wastewaters. This assay holds great promise for analyzing sediments or soils due to its high tolerance to inhibition, but further testing is required because of complexities of inhibitor mixes in these types of samples.

Protocol

1. Assay Mixture Preparation

1. Make 100 µmol/L stock concentrations for all primers in molecular grade water and probes in TE pH 8 buffer [Entero F1A, Entero R1, GPL813TQ ¹²; HF183-1, BthetR1, BthetP1³].
   Note: Probes for the two targets are fluorescently labeled with different fluorophores⁷ as indicated in List of Materials/Equipment.
2. Prepare master mix by mixing, per reaction planned, 12 µl digital PCR mix (2x stock, see List of Materials/Equipment), 0.216 µl each forward and reverse primer, 0.06 µl each fluorescent probe, and 5.016 µl nuclease free water (final concentration: 900 nM each primer, 250 nM each probe). Pipette up and down at least 10 times to mix while taking caution not to introduce air bubbles in the solution.
3. Pipette 18 µl master mix (from step 1.2) into a regular PCR tube or plate, mixing in 6 µl DNA template (extracted as described previously¹³) to make assay mixture for droplet generation. If running samples in duplicate, pipet 36 µl of master mix and 12 µl DNA template into each well. Leave the corresponding replicate wells empty on the plate. Include positive controls (see List of Materials/Equipment) and no template controls (NTC) (i.e. with molecular grade water used as the template).
   Note: Positive control is necessary to ensure the assay is running properly and the NTC is necessary to ensure there is no contamination within the plate and to set the fluorescent baseline later in data analysis. First time users are recommended to use both undiluted and diluted DNA samples.

2. Droplet Generation and PCR Plate Setup

1. Mix the assay mixtures by pipetting up down approximately 15 times using a multichannel pipet. Ensure that the pipet tip stays within liquid to avoid making excess bubbles within the mixture.
2. Insert cartridge 1 (containing 8 wells) into a white cartridge holder and click the cartridge holder shut. Cartridge 1 is now firmly in place and cannot be dislodged from the holder while generating droplets. Using a multichannel pipet, gently transfer 20 µl of assay mixture into the middle position of the cartridge marked 'Sample' without introducing air bubbles.
3. Pipet in 70 µl of droplet generation oil to the left side of the cartridge (marked 'Oil').
4. Cover cartridge with a gasket making sure the gasket is flat and held evenly by the 4 ticks toward the edge of the cartridge. Press the green-lit button on the droplet generator to open and place the cartridge. Press green-lit button again to close the generator.
   Note: Once the door closes, the button is dimmed, the door cannot be reopened and droplet generation begins immediately continuing for approximately 1 min.
5. If doing more than 8 reactions, place cartridge 2 in a second white cartridge holder and prepare in the same manner as cartridge 1 while the droplet generation is in progress to save total setup time.
6. Open the droplet generator door when the dim lit button turns green indicating completion of droplet generation. Remove the white cartridge holder containing cartridge 1, set aside, and place cartridge 2 onto the droplet generator.
7. Remove the gasket from cartridge 1 and discard. Gently transfer the total volume (approximately 40 µl) of generated droplets from the third column of the cartridge (marked 'Droplets') onto a final PCR plate (maintained at room temperature) for thermal cycling.
   Note: Do not unclick the white cartridge holder as the action may break the newly generated droplets; only open the cartridge holder after the droplets have been transferred to the final plate.
8. Repeat steps 2.1-2.7 for additional samples.
9. When all the droplets are in the final PCR plate, place a pierceable foil cover on top of the plate and place it on a plate sealer. Set the sealer to 180 °C, press 'Play' on the sealer and let seal for 10 sec.

3. Thermal Cycling and Droplet Reading

1. Place the sealed plate on the thermal cycler, one compatible with the final PCR plate used in step 2.7, and a temperature ramping speed of 2.0 °C/sec.
2. Run thermal program as follows: 10 min at 95 °C, followed by 40 cycles of 30 sec at 94 °C and 60 sec at 60 °C, followed by a 10 min hold at 98 °C (optional: final hold at 4 or 15 °C).
3. Upon completion of cycling, transfer the plate to a Droplet Reader for automatic measurement of fluorescence in each droplet in each well. Alternatively, store the plate at 4 °C for up to 3 days before droplet reading. Ensure the droplets are at room temperature before proceeding with reading.
   1. Open the accompanying software to setup the droplet reading. In the default 'Setup' menu containing a schematic of an empty 96 well plate, double click on well A1 to open the menu containing three sections: 'Sample,' 'Assay 1' and 'Assay 2.'
   2. In the 'Sample' section type the sample ID into the box labeled 'Name' and press enter or check the box to the right marked 'Apply.' Next, click the drop down menu labeled 'Experiment' and choose 'RED' (rare event detection) and click enter.
   3. Move to the section denoted 'Assay 1.' In the 'Name' section fill out the assay (e.g. Enterococcus) and click enter. In the box below labeled 'Type' click the drop down menu and choose 'Channel 1 Unknown' and click enter.
   4. Move to the section denoted 'Assay 2.' In the 'Name' section fill out the assay (e.g. HF183) and click enter. In the box below labeled 'Type' click the drop down menu and choose 'Channel 2 Unknown' and click enter. All the information from Steps 3.3.2 to 3.3.4 is now present in well A1.
   5. Name all subsequent wells containing droplets. To save total setup time, click 'Shift' or 'Ctrl,' to choose multiple wells simultaneously.
   6. When the digital depiction of the plate mirrors the physical plate, press 'OK' at the bottom right of the menu. In the new menu that appears at the top of the plate schematic, under the 'Template' section choose 'Save As' and name and save the plate.
   7. To the left of the screen click 'Run' and select appropriate Dye Set in the pop-out “Run Options” window. Data collection initiates and is displayed in real time in the software.

4. Data Analysis and Reporting

1. When the reader is finished and a box appears stating 'Run Complete', click 'OK'.
   Note: The software displays the final data file under the 'Analyze' section of the software. In this view, the software has all the wells in the plate selected and defaults to the '2D Amplitude' data plot.
2. Check the separation between the positive and negative droplets. Ensure that the fluorescence in all droplets in the NTC wells are near baseline.
3. Click on the button labeled 'Events.' To the right of the presented histogram click the box named ‘Total’ and the box named “single” at the bottom to display the total number of accepted droplets per well. Exclude any wells containing <10,000 droplets⁷ by holding the Ctrl key and clicking on the well(s) to be excluded.
4. Click on the button denoted as '1D Amplitude' to set the fluorescent threshold at approximately one standard deviation (500-700 fluorescence units) above the negative droplets in NTC wells for both targets. At the very left of the screen under the 'Auto Analyze' showing two threshold buttons, choose the icon to the right that has a solid pink horizontal line running through it.
5. Click in the box to the left of 'Set Threshold' under each of the amplitude graphs and enter the appropriate fluorescence threshold values. The target concentrations in copy per µl reaction are then automatically calculated.
   Note: The thresholds do not need to be identical for the different targets.
6. Export the results in a .csv file by clicking the 'Export' button in the upper left hand corner on the 1D Amplitude screen. In the .csv file, multiply the exported target concentration by 4 to convert it from copy of target (23S gene of Enterococcus spp. or the HF183 marker) per µl reaction to copy of target per µl DNA template.

Results

A good EntHF183 duplex dPCR run should result in relatively high number of accepted droplets (ca. 10,000-17,000) and relatively large difference (ca. 5,000) between fluorescence values for negative and positive droplets⁷. Unusually low number of droplets likely indicates issues in the droplet generation process, and a cutoff of 10,000 droplets is suggested based on empirical data from the droplet dPCR system used in this article. A weaker separation (i.e.<...

Discussion

There are a few critical steps in the protocol. First, mixing of the assay mixtures can be difficult because the master mix is more viscous than conventional qPCR master mixes. Simple vortexing may lead to insufficient mixing, which in turn leads to non-uniform distribution of DNA templates in the assay mixtures and subsequently in the droplets. The mixing-by-pipetting technique described in the protocol must be followed to ensure accurate dPCR quantification. Second, it is important to ensure droplets are generated at a...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Low Bind Microtubes	Costar	3207	For storage of reagents, samples/production of master mixes
Nuclease Free Water	FisherSci	BP2484-50
TE pH 8 buffer	FisherSci	BP2473-100
Hardshell 96 Well Plate	BioRad	HSP-9601	For initial master mix and sample inoculation
Aluminum Sealing Film	BioRad	359-0133	To seal sample plate
Droplet Generator	BioRad	186-3002
Droplet Generation Oil	BioRad	186-3005
Cartridge	BioRad	186-4008
DG8 Cartridge Holder	BioRad	186-3051
Gasket	BioRad	186-3009
20 μl pipet tips	Rainin	GP-L10F	For tansferring sample/master mix to cartidge
200 μl pipet tips	Rainin	GP-L200F	For transferring droplets to final Twin.Tec Plate
Twin.Tec 96 Well Plate	Eppendorf	951020320	For final droplets thermal cycling and reading
Pierceable Heat Seal Foil	BioRad	181-4040	To seal Twin.Tec plate before thermalcycling
PX1 PCR Plate Sealer	BioRad	181-4000
CFX96 Thermalcycler	BioRad	CFX96 and C1000	Only the thermal cycler is needed, no optics
QX100 Droplet Reader	BioRad	186-3001
Droplet Reader Oil	BioRad	186-3004
Droplet PCR Supermix	BioRad	186-3024	i.e. the digital PCR mix in manuscript
QuantaSoft software (v1.3.2)	Quantasoft	QX100	For viewing, analyzing, and exporting ddPCR data
Entero Forward Primer (Ent F1A)	Operon	GAGAAATTCCAAACGAACTTG	Alternative vendor can be used
Entero Reverse Primer (Ent R1)	Operon	CAGTGCTCTACCTCCATCATT	Alternative vendor can be used
Entero Probe (GPL813TQ)	Operon	[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]	Alternative vendor can be used, but the florophore has to be FAM
HF183 Forward Primer (HF183-1)	Operon	ATCATGAGTTCACATGTCCG	Alternative vendor can be used
HF183 Reverse Primer (BthetR1)	Operon	CGTAGGAGTTTGGACCGTGT	Alternative vendor can be used
HF183 Probe (BthetP1)	Operon	[6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1]	Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.
Positive control			Mixture of E. faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.