This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.
This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated HF183 marker. The EntHF183 duplex dPCR (referred as EntHF183 dPCR hereon) assay uses the same primer and probe sequences as its published individual quantitative PCR (qPCR) counterparts. Likewise, the same water filtration and DNA extraction procedures as performed prior to qPCR are followed prior to running dPCR. However, the duplex dPCR assay has several advantages over the qPCR assays. Most important, the dPCR assay eliminates the need for running a standard curve and hence, the associated bias and variability, by direct quantification of its targets. In addition, while duplexing (i.e. simultaneous quantification) Enterococcus and HF183 in qPCR often leads to severe underestimation of the less abundant target in a sample, dPCR provides consistent quantification of both targets, whether quantified individually or simultaneously in the same reaction. The dPCR assay is also able to tolerate PCR inhibitor concentrations that are one to two orders of magnitude higher than those tolerated by qPCR. These advantages make the EntHF183 dPCR assay particularly attractive because it simultaneously provides accurate and repeatable information on both general and human-associated fecal contamination in environmental waters without the need to run two separate qPCR assays. Despite its advantages over qPCR, the upper quantification limit of the dPCR assay with currently available instrumentation is approximately four orders of magnitude lower than that achievable by qPCR. Consequently, dilution is needed for measurement of high concentrations of target organisms such as those typically observed following sewage spills.
Quantitative PCR (qPCR) methods have been widely used for recreational water quality monitoring and microbial source tracking applications because they are faster, more flexible and specific compared to traditional culture-based methods. Consequently, qPCR is recommended for achieving rapid water monitoring results for general fecal indicators such as Enterococcus spp. in the revised USEPA recreational water quality criteria1. Many qPCR assays have also been developed and validated for identifying sources of fecal contamination in environmental waters2. Among these, the HF183 marker assays are among the most frequently used for identifying human-associated fecal contamination3.
However, qPCR results can often be biased because they rely on standard curves for quantification. qPCR quantifies unknown concentrations of target in samples by interpolating their quantification cycle (Cq) from a standard curve that describes a linear relationship between Cq and logarithmic quantity of a set of serially-diluted standards. Lack of reliable and consistent standard reference material can therefore greatly bias qPCR results. Studies showed that qPCR results differed by approximately half a log using standards from different vendors4 and by 2-fold using different batches of standards from the same vendor5.
Digital PCR (dPCR) technology quantifies an unknown sample by counting the frequency of positives in large numbers of miniature PCRs that are generated by partitioning a bulk qPCR into thousands or millions of uniform nanoliter or picoliter reactions6. It is referred as droplet digital PCR (i.e., this article) or chamber digital PCR, respectively, if the partitions are water-in-oil droplets (i.e., this article) or small chambers on a chip. A higher sample concentration will result in presence of target DNA (hence positive PCR) in a higher proportion of partitions, a relationship approximated by Poisson distribution. As such, the binary results (positive or negative PCR) are recorded and the frequency of positive droplets is used to calculate unknown sample concentrations directly via Poisson approximation, eliminating the need for a standard curve as in qPCR.
This binary nature of digital PCR quantification provides additional advantages over qPCR7. Because delayed amplification can still yield a positive PCR, dPCR quantification is more robust against inhibition that reduces amplification efficiency. Similarly, dPCR quantification is not affected by variability in Cq values as is qPCR, leading to higher precision of dPCR compared to qPCR8-10.
In addition, the partitioning process ensures a very small amount of target DNA present in each droplet, effectively minimizing substrate competition (during amplification of different DNA targets) that are common obstacles to achieving duplexing (i.e. an assay simultaneously measures two DNA targets) in qPCR. As such, whether run in duplex or simplex (i.e. one target is measured in a single assay) dPCR produces nearly indistinguishable quantification of both targets7,11.
The goal of the digital PCR assay (EntHF183 dPCR) described in this article is to obtain simultaneous direct quantification of the general fecal indicator Enterococcus spp. and the human-fecal associated HF183 marker with improved precision, reproducibility and robustness against inhibition compared to its qPCR counterparts. This assay has been successfully used for quantifying fecal contamination in environmental freshwater, marine water, and various fecal material7, but can also be applied to any other types of waters and wastewaters. This assay holds great promise for analyzing sediments or soils due to its high tolerance to inhibition, but further testing is required because of complexities of inhibitor mixes in these types of samples.
Access restricted. Please log in or start a trial to view this content.
1. Assay Mixture Preparation
2. Droplet Generation and PCR Plate Setup
3. Thermal Cycling and Droplet Reading
4. Data Analysis and Reporting
Access restricted. Please log in or start a trial to view this content.
A good EntHF183 duplex dPCR run should result in relatively high number of accepted droplets (ca. 10,000-17,000) and relatively large difference (ca. 5,000) between fluorescence values for negative and positive droplets7. Unusually low number of droplets likely indicates issues in the droplet generation process, and a cutoff of 10,000 droplets is suggested based on empirical data from the droplet dPCR system used in this article. A weaker separation (i.e.<...
Access restricted. Please log in or start a trial to view this content.
There are a few critical steps in the protocol. First, mixing of the assay mixtures can be difficult because the master mix is more viscous than conventional qPCR master mixes. Simple vortexing may lead to insufficient mixing, which in turn leads to non-uniform distribution of DNA templates in the assay mixtures and subsequently in the droplets. The mixing-by-pipetting technique described in the protocol must be followed to ensure accurate dPCR quantification. Second, it is important to ensure droplets are generated at a...
Access restricted. Please log in or start a trial to view this content.
The authors declare that they have no competing financial interests.
The authors have no acknowledgements.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Low Bind Microtubes | Costar | 3207 | For storage of reagents, samples/production of master mixes |
| Nuclease Free Water | FisherSci | BP2484-50 | |
| TE pH 8 buffer | FisherSci | BP2473-100 | |
| Hardshell 96 Well Plate | BioRad | HSP-9601 | For initial master mix and sample inoculation |
| Aluminum Sealing Film | BioRad | 359-0133 | To seal sample plate |
| Droplet Generator | BioRad | 186-3002 | |
| Droplet Generation Oil | BioRad | 186-3005 | |
| Cartridge | BioRad | 186-4008 | |
| DG8 Cartridge Holder | BioRad | 186-3051 | |
| Gasket | BioRad | 186-3009 | |
| 20 μl pipet tips | Rainin | GP-L10F | For tansferring sample/master mix to cartidge |
| 200 μl pipet tips | Rainin | GP-L200F | For transferring droplets to final Twin.Tec Plate |
| Twin.Tec 96 Well Plate | Eppendorf | 951020320 | For final droplets thermal cycling and reading |
| Pierceable Heat Seal Foil | BioRad | 181-4040 | To seal Twin.Tec plate before thermalcycling |
| PX1 PCR Plate Sealer | BioRad | 181-4000 | |
| CFX96 Thermalcycler | BioRad | CFX96 and C1000 | Only the thermal cycler is needed, no optics |
| QX100 Droplet Reader | BioRad | 186-3001 | |
| Droplet Reader Oil | BioRad | 186-3004 | |
| Droplet PCR Supermix | BioRad | 186-3024 | i.e. the digital PCR mix in manuscript |
| QuantaSoft software (v1.3.2) | Quantasoft | QX100 | For viewing, analyzing, and exporting ddPCR data |
| Entero Forward Primer (Ent F1A) | Operon | GAGAAATTCCAAACGAACTTG | Alternative vendor can be used |
| Entero Reverse Primer (Ent R1) | Operon | CAGTGCTCTACCTCCATCATT | Alternative vendor can be used |
| Entero Probe (GPL813TQ) | Operon | [6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1] | Alternative vendor can be used, but the florophore has to be FAM |
| HF183 Forward Primer (HF183-1) | Operon | ATCATGAGTTCACATGTCCG | Alternative vendor can be used |
| HF183 Reverse Primer (BthetR1) | Operon | CGTAGGAGTTTGGACCGTGT | Alternative vendor can be used |
| HF183 Probe (BthetP1) | Operon | [6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1] | Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen. |
| Positive control | Mixture of E. faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA. |
Access restricted. Please log in or start a trial to view this content.