A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Summary

This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

Abstract

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated HF183 marker. The EntHF183 duplex dPCR (referred as EntHF183 dPCR hereon) assay uses the same primer and probe sequences as its published individual quantitative PCR (qPCR) counterparts. Likewise, the same water filtration and DNA extraction procedures as performed prior to qPCR are followed prior to running dPCR. However, the duplex dPCR assay has several advantages over the qPCR assays. Most important, the dPCR assay eliminates the need for running a standard curve and hence, the associated bias and variability, by direct quantification of its targets. In addition, while duplexing (i.e. simultaneous quantification) Enterococcus and HF183 in qPCR often leads to severe underestimation of the less abundant target in a sample, dPCR provides consistent quantification of both targets, whether quantified individually or simultaneously in the same reaction. The dPCR assay is also able to tolerate PCR inhibitor concentrations that are one to two orders of magnitude higher than those tolerated by qPCR. These advantages make the EntHF183 dPCR assay particularly attractive because it simultaneously provides accurate and repeatable information on both general and human-associated fecal contamination in environmental waters without the need to run two separate qPCR assays. Despite its advantages over qPCR, the upper quantification limit of the dPCR assay with currently available instrumentation is approximately four orders of magnitude lower than that achievable by qPCR. Consequently, dilution is needed for measurement of high concentrations of target organisms such as those typically observed following sewage spills.

Introduction

Quantitative PCR (qPCR) methods have been widely used for recreational water quality monitoring and microbial source tracking applications because they are faster, more flexible and specific compared to traditional culture-based methods. Consequently, qPCR is recommended for achieving rapid water monitoring results for general fecal indicators such as Enterococcus spp. in the revised USEPA recreational water quality criteria¹. Many qPCR assays have also been developed and validated for identifying sources of fecal contamination in environmental waters². Among these, the HF183 marker assays are among the most frequently used for identifyi....

Protocol

1. Assay Mixture Preparation

1. Make 100 µmol/L stock concentrations for all primers in molecular grade water and probes in TE pH 8 buffer [Entero F1A, Entero R1, GPL813TQ ¹²; HF183-1, BthetR1, BthetP1³].
   Note: Probes for the two targets are fluorescently labeled with different fluorophores⁷ as indicated in List of Materials/Equipment.
2. Prepare master mix by mixing, per reaction planned, 12 µl digital PCR mix (2x stock, see List of Materials/Equipment), 0.216 µl each forward and reverse primer, 0.06 µl each fluorescent probe, and 5.016 µl nuclease free water (final concentration: 900 nM....

Results

A good EntHF183 duplex dPCR run should result in relatively high number of accepted droplets (ca. 10,000-17,000) and relatively large difference (ca. 5,000) between fluorescence values for negative and positive droplets⁷. Unusually low number of droplets likely indicates issues in the droplet generation process, and a cutoff of 10,000 droplets is suggested based on empirical data from the droplet dPCR system used in this article. A weaker separation (i.e.<.......

Discussion

There are a few critical steps in the protocol. First, mixing of the assay mixtures can be difficult because the master mix is more viscous than conventional qPCR master mixes. Simple vortexing may lead to insufficient mixing, which in turn leads to non-uniform distribution of DNA templates in the assay mixtures and subsequently in the droplets. The mixing-by-pipetting technique described in the protocol must be followed to ensure accurate dPCR quantification. Second, it is important to ensure droplets are generated at a.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Low Bind Microtubes	Costar	3207	For storage of reagents, samples/production of master mixes
Nuclease Free Water	FisherSci	BP2484-50
TE pH 8 buffer	FisherSci	BP2473-100
Hardshell 96 Well Plate	BioRad	HSP-9601	For initial master mix and sample inoculation
Aluminum Sealing Film	BioRad	359-0133	To seal sample plate
Droplet Generator	BioRad	186-3002
Droplet Generation Oil	BioRad	186-3005
Cartridge	BioRad	186-4008
DG8 Cartridge Holder	BioRad	186-3051
Gasket	BioRad	186-3009
20 μl pipet tips	Rainin	GP-L10F	For tansferring sample/master mix to cartidge
200 μl pipet tips	Rainin	GP-L200F	For transferring droplets to final Twin.Tec Plate
Twin.Tec 96 Well Plate	Eppendorf	951020320	For final droplets thermal cycling and reading
Pierceable Heat Seal Foil	BioRad	181-4040	To seal Twin.Tec plate before thermalcycling
PX1 PCR Plate Sealer	BioRad	181-4000
CFX96 Thermalcycler	BioRad	CFX96 and C1000	Only the thermal cycler is needed, no optics
QX100 Droplet Reader	BioRad	186-3001
Droplet Reader Oil	BioRad	186-3004
Droplet PCR Supermix	BioRad	186-3024	i.e. the digital PCR mix in manuscript
QuantaSoft software (v1.3.2)	Quantasoft	QX100	For viewing, analyzing, and exporting ddPCR data
Entero Forward Primer (Ent F1A)	Operon	GAGAAATTCCAAACGAACTTG	Alternative vendor can be used
Entero Reverse Primer (Ent R1)	Operon	CAGTGCTCTACCTCCATCATT	Alternative vendor can be used
Entero Probe (GPL813TQ)	Operon	[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]	Alternative vendor can be used, but the florophore has to be FAM
HF183 Forward Primer (HF183-1)	Operon	ATCATGAGTTCACATGTCCG	Alternative vendor can be used
HF183 Reverse Primer (BthetR1)	Operon	CGTAGGAGTTTGGACCGTGT	Alternative vendor can be used
HF183 Probe (BthetP1)	Operon	[6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1]	Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.
Positive control			Mixture of E. faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.