A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

17.3K views

DOI:

10.3791/53843

April 30th, 2016

In This Article

Summary

Using DNA assembly, multiple CRISPR vectors can be constructed in parallel in a single cloning reaction, making the construction of large numbers of CRISPR vectors a simple task. Tomato hairy roots are an excellent model system to validate CRISPR vectors and generate mutant materials.

Abstract

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

Introduction

The ability to generate targeted DNA modifications with CRISPR/Cas9 has great potential for functional genomics studies. There are two components of the CRISPR/Cas9 system; the Cas9 nuclease, derived from Staphylococcus pyogenes and an approximately 100-nt guide RNA (gRNA) molecule that directs Cas9 to the targeted DNA site(s)1. Target recognition is conferred by the first ~20-nt of the gRNA, which allows for high-throughput production of targeting vectors2,3. Most organisms that can be engineered, already have been with CRISPR/Cas9 technology4,5.

In plants, constitutive promoters, such as the CaMV ....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Guide RNA Design and Vector Construction

  1. Identify target sequences for the genes of interest. There are a variety of online CRISPR target-finding programs suitable for this step13,14.
    NOTE: Here we use the GN20GG target motif, but other designs may be suitable depending on the application or vector system used.
  2. Design 60-mer gRNA oligos to include the GN19 portion of the target motifs flanked by 5' and 3' 20-nt sequences that are required for DNA assembly. The final 60-mer motif is: 5'-TCAAGCGAACCAGTAGGCTT-GN19-GTTTTAGAGCTAGAAATAGC-3'.
    NOTE: Standard, desalted primers wo....

Access restricted. Please log in or start a trial to view this content.

Results

CRISPR vector construction with DNA assembly typically generates tens to hundreds of independent clones. Colony screening by PCR easily identifies correct clones and can distinguish between plasmids with and without inserts (Figure 2A) which is useful for troubleshooting. Typically, all of the clones contain an insert and a user may opt to skip the colony screening steps altogether. Diagnostic digests (Figure 2B) and Sanger sequencing are used for quality.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This research was supported by National Science Foundation grant IOS-1025642 (GBM). We thank Maria Harrison for providing the ARqua1 strain.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
NEBuilder® (HiFi DNA assembly mix)New England BiolabsE5520
p201N:Cas9Addgene59175The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.
pUC gRNA ShuttleAddgene47024
SwaINew England BiolabsR0604S
SpeINew England BiolabsR0133S
Zymo clean and concentrator-5 column purificationZymo ResearchD4003
NEB Buffer 2.1New England BiolabsB7202S
NEB CutSmart (Buffer 4)New England BiolabsB7204S
NEB Buffer 3.1New England BiolabsB7203S
EconoSpin Mini Spin Column (plasmid prep)Epoch Life Sciences1910-050/250
EcoRV-HF®New England BiolabsR3195S
StyI-HF®New England BiolabsR3500S
MS Salts + Gamborg VitaminsPhytotechnology LaboratoriesM404
Phytagel™ (gellan gum)Sigma AldrichP8169
GA-7 BoxesSigma AldrichV8505
Micropore™ surgical tape3M1535-0
Timentin® (Ticarcillin/Clavulanic acid)Various0029-6571-26
Primers 5' → 3'
SwaI_MtU6F GATATTAATCTCTTCGATGA
AATTT
ATGCCTATCTTATAT
GATCAATGAGG
MtU6R  AAGCCTACTGGTTCGCTTG
AAG
ScaffoldF GTTTTAGAGCTAGAAATAGC
AAGTT
SpeI_Scaffold RGTCATGAATTGTAATACGACTC
A
AAAAAAAGCACCGACTCGGTG
StUbi3P218R ACATGCACCTAATTTCACTA
GATGT
ISceIRGTGATCGATTACCCTGTTAT
CCCTAG
Cannot be used for Sanger sequencing since there is a second binding site on the plasmid
UNS1_Scaffold R GAGAATGGATGCGAGTAATGAA
AAAAAGCACCGACTCGGTG
UNS1_MtU6 F  CATTACTCGCATCCATTCTCAT
GCCTATCTTATATGATCAATGAGG
p201R CGCGCCGAATTCTAGTGATCG
Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
  2. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

DNA Assembly MethodGuide RNA DesignRestriction Enzyme DigestionDNA Amplification PCRPlasmid PurificationAgrobacterium TransformationGenetic Mutation AnalysisFunctional Genomics Studies