High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Summary

Using DNA assembly, multiple CRISPR vectors can be constructed in parallel in a single cloning reaction, making the construction of large numbers of CRISPR vectors a simple task. Tomato hairy roots are an excellent model system to validate CRISPR vectors and generate mutant materials.

Abstract

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

Introduction

The ability to generate targeted DNA modifications with CRISPR/Cas9 has great potential for functional genomics studies. There are two components of the CRISPR/Cas9 system; the Cas9 nuclease, derived from Staphylococcus pyogenes and an approximately 100-nt guide RNA (gRNA) molecule that directs Cas9 to the targeted DNA site(s)¹. Target recognition is conferred by the first ~20-nt of the gRNA, which allows for high-throughput production of targeting vectors^2,3. Most organisms that can be engineered, already have been with CRISPR/Cas9 technology^4,5.

In plants, constitutive promoters, such as the CaMV ....

Protocol

1. Guide RNA Design and Vector Construction

1. Identify target sequences for the genes of interest. There are a variety of online CRISPR target-finding programs suitable for this step^13,14.
   NOTE: Here we use the GN₂₀GG target motif, but other designs may be suitable depending on the application or vector system used.
2. Design 60-mer gRNA oligos to include the GN₁₉ portion of the target motifs flanked by 5' and 3' 20-nt sequences that are required for DNA assembly. The final 60-mer motif is: 5'-TCAAGCGAACCAGTAGGCTT-GN₁₉-GTTTTAGAGCTAGAAATAGC-3'.
   NOTE: Standard, desalted primers wo....

Results

CRISPR vector construction with DNA assembly typically generates tens to hundreds of independent clones. Colony screening by PCR easily identifies correct clones and can distinguish between plasmids with and without inserts (Figure 2A) which is useful for troubleshooting. Typically, all of the clones contain an insert and a user may opt to skip the colony screening steps altogether. Diagnostic digests (Figure 2B) and Sanger sequencing are used for quality.......

Discussion

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes^17,18, or overlap-extension PCR¹⁹. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
NEBuilder® (HiFi DNA assembly mix)	New England Biolabs	E5520
p201N:Cas9	Addgene	59175	The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.
pUC gRNA Shuttle	Addgene	47024
SwaI	New England Biolabs	R0604S
SpeI	New England Biolabs	R0133S
Zymo clean and concentrator-5 column purification	Zymo Research	D4003
NEB Buffer 2.1	New England Biolabs	B7202S
NEB CutSmart (Buffer 4)	New England Biolabs	B7204S
NEB Buffer 3.1	New England Biolabs	B7203S
EconoSpin Mini Spin Column (plasmid prep)	Epoch Life Sciences	1910-050/250
EcoRV-HF®	New England Biolabs	R3195S
StyI-HF®	New England Biolabs	R3500S
MS Salts + Gamborg Vitamins	Phytotechnology Laboratories	M404
Phytagel™ (gellan gum)	Sigma Aldrich	P8169
GA-7 Boxes	Sigma Aldrich	V8505
Micropore™ surgical tape	3M	1535-0
Timentin® (Ticarcillin/Clavulanic acid)	Various	0029-6571-26
Primers 5' → 3'
SwaI_MtU6F	GATATTAATCTCTTCGATGA AATTTATGCCTATCTTATAT GATCAATGAGG
MtU6R	AAGCCTACTGGTTCGCTTG AAG
ScaffoldF	GTTTTAGAGCTAGAAATAGC AAGTT
SpeI_Scaffold R	GTCATGAATTGTAATACGACTC AAAAAAAAGCACCGACTCGGTG
StUbi3P218R	ACATGCACCTAATTTCACTA GATGT
ISceIR	GTGATCGATTACCCTGTTAT CCCTAG	Cannot be used for Sanger sequencing since there is a second binding site on the plasmid
UNS1_Scaffold R	GAGAATGGATGCGAGTAATGAA AAAAAGCACCGACTCGGTG
UNS1_MtU6 F	CATTACTCGCATCCATTCTCAT GCCTATCTTATATGATCAATGAGG
p201R	CGCGCCGAATTCTAGTGATCG
Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.