A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

10.5K views

DOI:

10.3791/54119

July 3rd, 2016

In This Article

Summary

We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 β-lactamase selected at a clinically relevant dosage of ampicillin are provided.

Abstract

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 β-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to β-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

Introduction

Mutagenesis has long been employed in the laboratory to study the properties of biological systems and their evolution, and to produce mutant proteins or organisms with enhanced or novel functions. While early approaches relied on methods which produce random mutations in organisms, the advent of recombinant DNA technology enabled researchers to introduce select changes to DNA in a site-specific manner, i.e., site-directed mutagenesis1,2. With current techniques, typically using mutagenic oligonucleotides in a polymerase chain reaction (PCR), it is relatively facile to create and assess small numbers of mutations (e.g., point mutations) in a given gene3,4. It is far more difficult however when the goal approaches, for example, the creation and assessment of all possible single-site (or higher-order) mutations.

While much has been learned from early studies attempting to assess large numbers of mutations in genes, the techniques used were often laborious, for example requiring the assessment of each mutation independently using nonsense suppressor strains5-7, or were limited in their quantitative ability due to the low sequencing depth of Sanger sequencing8. The techniques used in these studies have largely been supplanted by methods utilizing high-throughput sequencing technology9-12. These conceptually simple approaches entail creating a library comprising a large number of mutations, subjecting the library to a screen or selection for function, and then deep-sequencing (i.e., on the order of >106 sequencing reads) the library obtained before and after selection. In this way, the phenotypic or fitness effects of a large number of mutations, represented as the change in population frequency of each mutant, can be assessed simultaneously and more quantitatively.

We previously introduced a simple approach for assessing libraries of all possible single amino acid mutations in proteins (i.e., whole-protein saturation mutagenesis libraries), applicable to genes with a length longer than the sequencing read length11,13: First, each amino acid position is randomized by site-directed mutagenic PCR. During this process, the gene is split into groups composed of contiguous positions with a total length accommodated by the sequencing platform. The mutagenic PCR products for each group are then combined, and each group independently subjected to selection and high-throughput sequencing. By maintaining a correspondence between the location of mutations in the sequence and the sequencing read length, this approach has the advantage of maximizing sequencing depth: while one could simply sequence such libraries in short windows without splitting into groups (e.g., by a standard shotgun sequencing approach), most reads obtained would be wild-type and thus the majority of sequencing throughput wasted (e.g., for a whole-protein saturation mutagenesis library of a 500 amino acid protein sequenced in 100 amino acid (300 bp) windows, at minimum 80% of reads will be the wild-type sequence).

Here, a protocol is presented which utilizes high-throughput sequencing for the functional assessment of whole-protein saturation mutagenesis libraries, using the above approach (outlined in Figure 1). Importantly, we introduce the usage of orthogonal primers in the library cloning process to barcode each sequence group, which allows them to be multiplexed into one library, subjected simultaneously to screening or selection, and then de-multiplexed for deep sequencing. Since the sequence groups are not subjected to selection independently, this reduces the workload and ensures that each mutation experiences the same level of selection. TEM-1 β-lactamase, an enzyme which confers high-level resistance to β-lactam antibiotics (e.g., ampicillin) in bacteria is used as a model system14-16. A protocol is described for the assessment of a whole-protein saturation mutagenesis library of TEM-1 in E. coli under selection at an approximate serum level for a clinical dose of ampicillin (50 µg/ml)17,18.

Access restricted. Please log in or start a trial to view this content.

Protocol

Note: See Figure 1 for outline of protocol. Several steps and reagents in the protocol require safety measures (indicated with "CAUTION"). Consult material safety data sheets before use. All protocol steps are performed at RT unless other indicated.

1. Prepare Culture Media and Plates

  1. Prepare and sterilize by autoclaving 1 L purified water, 100 ml Super Optimal Broth (SOB; Table 1), 1 L Luria-Bertani broth (LB; Table 2) and 1 L LB-agar (Table 3). Prepare separately and sterilize three culture flasks each containing 1 L LB.
    Note: Throughout the protocol "water" refers to autoclave-sterilized purified water; SOB, LB and LB-agar refer to the autoclave-sterilized solutions.
  2. Prepare a 12 mg/ml stock of Tet by dissolving 0.12 g tetracycline hydrochloride in 10 ml of 70% ethanol. Sterilize using a 0.2 µm filter and store at 4 °C protected from light.
  3. Cool LB-agar to 50 °C and then add 1 ml of Tet stock (final concentration of 12 µg/ml Tet). Pour into petri plates and cool at RT protected from light. Store at 4 °C protected from light.

2. Construction of the Whole-gene Saturation Mutagenesis Library

Note: Primers; completed PCRs, restriction digests and ligations; and purified DNA samples can be stored at -20 °C.

  1. Designing mutagenesis primers
    1. To mutagenize each amino acid position to all possible amino acids, design a pair of complementary mutagenesis primers (sense/forward and antisense/reverse) for each amino acid position with the following guidelines:
      1. Replace the codon corresponding to the amino acid to be mutagenized by NNS (where N is a mixture of all four nucleotide bases and S is a mixture of cytosine (C) and guanine (G)) and center in the primer, flanked by approximately 15 nucleotides on each side.
      2. Ensure that the 5' and 3' ends terminate in C or G and that the melting temperature (Tm) is approximately 70 °C3. Use the computational script NNS_PrimerDesign.m (See Supplementary Code File) to design NNS mutagenesis primers according to these guidelines.
    2. Order primers from a commercial source. For ease of use, have them synthesized in 96-well plate format and pre-diluted in water to 50 µM, with one set of plates containing the sense mutagenesis primers and another the antisense primers.
    3. Fill a pipette basin with water and use a multichannel pipette to transfer 95 µl to 263 wells over three 96-well plates. Dilute the primers 20-fold to 2.5 µM by using a multichannel pipette to transfer 5 µl from the 96-well plates containing the sense mutagenesis primers to the cognate wells of the plates containing water.
    4. Repeat protocol step 2.1.3 to dilute the antisense mutagenesis primers.
  2. Synthesis of NNS sub-libraries for each amino acid position by two-step PCR site-directed mutagenesis
    1. Perform the first-round mutagenic PCRs. For each mutagenesis primer, prepare a 25 µl PCR reaction using pBR322_AvrII plasmid as template and primers AatII_F or AvrII_R (sense mutagenesis primers paired with primer AvrII_R, and antisense mutagenesis primers paired with primer AatII_F; total of 526 PCRs). See Table of Materials for AatII_F and AvrII_R sequences.
      1. Prepare a PCR "master mix" by adding the reagents from Table 4 to a 15 ml conical tube. Transfer to a pipette basin. Use a multichannel pipette to transfer 15 µl to 263 wells over three 96-well PCR plates. Use a multichannel pipette to transfer 10 µl from the 96-well plates containing the diluted sense mutagenesis primers to the cognate wells in the PCR plates.
      2. Cover each PCR plate with a 96-well plate seal. Centrifuge at 200 x g for 2 min.
      3. Transfer the PCR plates to thermocycler and run the following program: 98 °C for 30 sec; 20 cycles: 98 °C for 10 sec, 55 °C for 20 sec, 72 °C for 1 min; 72 °C for 2 min; hold at 4 °C.
      4. Repeat protocol steps 2.2.1.1 - 2.2.1.3 for the 96-well plates containing the diluted antisense mutagenesis primers.
    2. Perform the second-round mutagenic PCRs. For each amino acid position, prepare a 25 µl PCR reaction using primers AatII_F and AvrII_R, and the mixed and diluted first-round mutagenic PCR products as a template (total of 263 PCRs).
      1. Fill a pipette basin with water and use a multichannel pipette to transfer 198 µl to 263 wells over three 96-well plates.
      2. Combine and dilute 100-fold the mutagenic PCR products for each amino acid position by using a multichannel pipette to first transfer 1 µl from the 96-well PCR plates containing the PCR products resulting from the sense mutagenesis primers to the cognate wells of the plates containing water. Then repeat the transfer for the PCR products resulting from the antisense mutagenesis primers.
      3. Prepare a PCR "master mix" by adding the reagents from Table 5 to a 15 ml conical tube. Transfer to a pipette basin. Use a multichannel pipette to transfer 24 µl to 263 wells over three 96-well PCR plates. Use a multichannel pipette to transfer 1 µl from the 96-well plates containing the mixed and diluted first-round mutagenic PCR products to the cognate wells in the PCR plates.
      4. Cover each PCR plate with a 96-well plate seal. Centrifuge at approximately 200 x g for 2 min. Transfer plates to thermocycler and run the same program as in protocol step 2.2.1.3.
    3. Analyze results of the second-round mutagenic PCRs by gel electrophoresis. Ensure that all products are of the correct size and absent of contaminating products.
      1. Add 2 ml of 2x gel loading dye to a pipette basin and then use a multichannel pipette to transfer 6 µl to 263 wells over three 96-well plates. Use a multichannel pipette to transfer 6 µl from the 96-well PCR plates containing the second-round mutagenic PCR products to the cognate wells of the 96-well plates containing dye.
      2. Prepare a 1.5% agarose gel with 0.2 µg/ml ethidium bromide (CAUTION).
      3. Load DNA ladder in first and last lanes of each row. Then use a multichannel pipette to load 10 µl of samples from protocol step 2.2.3.1.
      4. Run the gel at 100 V for 40 min and image on a UV transilluminator.
      5. Repeat protocol steps 2.2.3.2 - 2.2.3.4 until all samples are analyzed.
    4. Accurately measure the concentration of each NNS sub-library PCR product using a dsDNA quantitation reagent.
      1. Transfer approximately 15 ml EB buffer to a pipette basin. Use a multichannel pipette to transfer 49 µl to 263 wells over three 96-well black-walled, clear bottom assay plates.
      2. Use a multichannel pipette to transfer 1 µl of each second-step PCR product (protocol step 2.2.2) to the cognate wells of the 96-well assay plates.
      3. Prepare a DNA concentration standard curve by diluting lambda phage DNA to 2 ng/µl in 300 µl EB buffer and then make ten two-fold dilutions (for total of 11 concentrations). Transfer 50 µl to first eleven columns of a row of one of the 96-well assay plates from the previous step which contains no sample; to the twelfth column add 50 µl of EB buffer (reagent blank).
      4. Prepare dsDNA quantitation reagent by adding 75 µl of reagent (see Table of Materials) to a 15 ml conical tube, then add 15 ml of EB buffer. Mix by inverting tube and then transfer to a pipette basin. Protect reagent from light.
      5. Use a multichannel pipette to transfer 50 µl of prepared dsDNA quantitation reagent to each well of the assay plates. Mix by pipetting up-and-down. Incubate plates at RT for 5 min protected from light.
      6. Measure fluorescence of each sample using a microplate reader and standard fluorescein wavelengths (excitation 485 nm, emission 520 nm; 0.1 sec).
      7. Subtract the fluorescence value of the reagent blank from all the samples. Generate a standard curve from the fluorescence measurements of lambda phage samples. Calculate the concentration of each sample using their respective fluorescence measurements and the standard curve.
  3. Cloning of NNS sub-libraries into selection vectors
    1. Mix 100 ng of each NNS sub-library PCR product into five NNS sub-library groups. Following manufacturers' instructions, clean up samples using a DNA purification kit and then measure concentration using a dsDNA quantitation reagent.
      Note: Each group is composed of approximately 53 contiguous amino acids positions spaced along the TEM-1 sequence (NNS sub-library groups 1 - 5 are comprised of positions 26 - 78, 79 - 132, 133 - 183, 184 - 236, and 237 - 290, respectively; numbering according to Ambler et al.19).
    2. Create cloning vectors for each NNS sub-library group.
      1. Prepare five 100 µl PCRs according to Table 6, using primers AvrII_F and AatII_OP1_R - AatII_OP5_R, and plasmids pBR322_OP1-5 as template (AatII_OP1_R paired with pBR322_OP1, etc.).
      2. Transfer to thermocycler and run the following program: 98 °C for 30 sec; 25 cycles: 98 °C for 10 sec, 55 °C for 20 sec, 72 °C for 1.5 min; 72 °C for 2 min; hold at 4 °C. See Table of Materials for sequences of AatII_R and AvrII_F.
      3. Prepare a 1% agarose gel with 0.2 µg/ml ethidium bromide (CAUTION).
      4. Add 20 µl of 6x gel loading dye to each PCR sample. Load the first lane of the gel with DNA ladder; load entire volume of each sample, skipping at least one well between samples.
      5. Run gel at 100 V for 50 min.
      6. Visualize gel using a long-wavelength UV illuminator (CAUTION). Excise slices containing the PCR product at ~3,500 bp; transfer to separate microfuge tubes. Gel slices can be stored at -20 °C.
      7. Following manufacturers' instructions, purify samples using a gel extraction kit and measure concentration using a dsDNA quantitation reagent.
    3. For both the NNS sub-library groups (protocol step 2.3.1) and cloning vectors (protocol step 2.3.2), set up restriction digests with AatII and AvrII enzymes according to Table 7. Incubate at 37 °C for 1 hr. Following manufacturers' instructions, clean up samples using a DNA purification kit and then measure concentration using a dsDNA quantitation reagent.
    4. Set up ligation reactions following Table 8 for each restriction-digested NNS sub-library group with cognate restriction-digested cloning vector (NNS sub-library group 1 with pBR322_OP1, etc.). Incubate at RT for 1 hr. Clean up reactions using a DNA purification kit according to manufacturer's instructions; elute DNA with 20 µl of water.
    5. Transform the entirety of the purified ligation reactions into library-efficient E. coli cells by electroporation.
      1. Thaw electrocompetent E. coli cells and then place cells and purified ligation reactions on ice.
      2. Transfer 10 µl thawed cells to each purified ligation reaction and then transfer to electroporation cuvette. Electroporate at 1.8 kV.
      3. Recover cells by resuspending in 1 ml SOB. Incubate for 1 hr at 37 °C.
      4. Resuspend 10 µl of each recovery culture in 990 µl LB; spread 100 µl on LB-agar plates containing 12 µg/ml Tet. Incubate plates O/N (~16 hr) at 37 °C.
      5. For each recovery culture, prepare a 250 ml culture flask with 50 ml LB and 50 µl Tet stock. Transfer to flask the remaining ~1 ml of recovery culture. Incubate O/N (~16 hr) at 37 °C with vigorous shaking (~200 rpm).   
    6. Count the number of colonies on each plate. Calculate the number of successful transformants as Stoichiometry equation, N*VC/VP, chemical reaction analysis., where Static equilibrium, ΣFx=0 diagram, lever system example in physics education. is the number of colonies, Venn diagram with V^C, set theory, intersection and union, mathematical concepts. is the recovery culture volume (1,000 µl) and Static equilibrium equation V^P symbol in scientific diagram for research analysis. is volume of the recovery culture plated (1 µl).
      Note: To ensure complete coverage of all mutations, as a rule of thumb the number of successful transformants should be ≥100-fold over the number of expected mutations. Each NNS sub-library has ~53 positions, so the expected number of mutations is 53 positions × 32 codons/position ≈ 1.7 × 103; to give a library size ≥100-fold (≥1.7 × 105) there should be ≥170 colonies on each plate.
    7. According to manufacturer's instructions, isolate plasmid DNA from cultures using a plasmid purification kit and then measure concentrations using a dsDNA quantitation reagent. Mix together 100 ng of each plasmid. This creates the final whole-protein saturation mutagenesis library.

3. Selection of the TEM-1 Whole-protein Saturation Mutagenesis Library for Antibiotic Resistance

  1. Preparation of the pre-selection culture.
    1. Dilute the plasmid from protocol step 2.3.7 to 0.5 ng/µl in water and transfer 20 µl to a microcentrifuge tube. Perform transformation, recovery, plating and O/N growth as previously described in protocol step 2.3.5, except transfer 1 µl of the SOB recovery culture to 999 µl LB.
    2. Count the number of colonies. To ensure complete coverage of all mutations there should be ≥100 colonies, indicating ≥106 successful transformants (100 × 263 positions × 32 codons/position ≈ 106).
    3. Measure the concentration of the 50 ml O/N culture.
      1. Prepare an LB blank by adding 1 ml LB to a spectrophotometer cuvette. Measure OD600 on a spectrophotometer.
      2. Dilute the O/N culture 10-fold by resuspending 100 µl in 900 µl LB. Measure the OD600. Subtract the OD600 reading of the blank and multiply by 10 to give the OD600 of the O/N culture.
    4. Pre-warm the three culture flasks from protocol step 1.1 for ~30 min at 37 °C. Dilute the O/N culture to OD600 = 0.1 and add 1 ml to one flask (final OD600 = 0.001). This is the "pre-selection culture".
    5. Incubate the "pre-selection culture" at 37 °C with vigorous shaking (200 rpm). Periodically monitor growth by measuring OD600 as in protocol step 3.1.3 (it is not necessary to dilute culture 10-fold) until OD600 = 0.1 (~2.5 hr).
    6. Transfer 100 ml of the pre-selection culture to two 50 ml conical tubes. Centrifuge at 4,000 x g for 6 min at 4 °C. Remove most of supernatant and combine into a single 15 conical tube. Repeat centrifugation and remove all supernatant. Store at -20 °C.
  2. Selection for ampicillin resistance.
    1. While the pre-selection culture is incubating, prepare a 50 mg/ml stock of Amp in water by dissolving 0.5 g sodium ampicillin in 10 ml water. Sterilize using a 0.2 µm filter and store at 4 °C.
    2. To the other two flasks, add Tet to a final concentration of 12 µg/ml and a volume of the pre-selection culture such that the final OD600 = 0.001. To one flask, add 1 ml Amp, for a final concentration of 50 µg/ml - this is the "selection culture".
    3. Incubate the cultures at 37 °C with vigorous shaking (200 rpm). Monitor growth of the culture for which no ampicillin was added in the previous step, until OD600 = 0.1 (~2.5 hr). At this time, also measure the OD600 of the selection culture.
    4. Divide the OD600 of the selection culture into 0.1 and multiply by 100 ml. Transfer this volume (~400 ml) to 50 ml conical tubes and centrifuge at 4,000 x g for 6 min at 4 °C. Remove most of supernatant and combine into a single 15 conical tube. Repeat centrifugation and remove all supernatant.
    5. According to manufacturer's instructions, isolate plasmid DNA from the pre-selection (protocol step 3.1.6) and selection (protocol step 3.2.4) culture cell pellets and then measure concentrations using a dsDNA quantitation reagent.

4. High-throughput Sequencing to Determine the Fitness Effects of Mutations

  1. Preparation of samples for high-throughput sequencing
    1. Prepare 25 µl PCRs to de-multiplex the NNS sub-library groups with orthogonal primers
      1. Prepare a PCR master mix according to Table 9; transfer 23 µl to ten PCR tubes.
      2. Add 1 µl of 0.5 ng/µl purified plasmid DNA from the pre-selection culture to PCR tubes 1 - 5 and from the selection culture to tubes 6 - 10.
      3. Mix together 50 µl of 50 µM forward orthogonal primers OP1_F - OP5_F with the respective reverse orthogonal primers OP1_R - OP5_R. In the same order, transfer 1 µl to PCR tubes 1 - 5 and 6 - 10. See Table of Materials for sequences of OP1_F - OP5_F and OP1_R - OP5_R.
      4. Transfer PCR tubes to thermocycler. Run the following program: 98 °C for 30 sec; 20 cycles: 98 °C for 10 sec, 55 °C for 20 sec, 72 °C for 1.5 min; 72 °C for 2 min; hold at 4 °C.
    2. Prepare 25 µl PCRs to isolate each of the NNS sub-library groups
      1. Dilute 100-fold the ten PCRs from protocol step 4.1.1.4 by transferring 1 µl of each to separate PCR tubes and adding 99 µl of water. Mix, then pipette out 99 µl and discard.
      2. Mix together 50 µl of 50 µM forward primers Group1_F - Group5_F with the respective reverse primers Group1_R - Group5_R. In the same order, transfer 1 µl to PCR tubes 1 - 5 and 6 - 10. See Table of Materials for sequences of Group1_F - Group5_F and Group1_R - Group5_R.
      3. Prepare a PCR master mix according to Table 9, transfer 23 µl to each PCR tube. Transfer PCR tubes to thermocycler; run the same program as in protocol step 2.2.1.3.
    3. Carry out the final 25 µl PCRs to add indexing sequences
      1. Dilute 100-fold the ten PCRs from protocol step 4.1.2.3 by transferring 1 µl of each to separate PCR tubes and adding 99 µl of water. Mix, then pipette out 99 µl and discard.
      2. Prepare a PCR master mix according to Table 9, transfer 23 µl to each PCR tube.
      3. For tubes with template originating from NNS sub-library groups 1-5, transfer 0.5 µl per tube forward primers 501_F - 505_F respectively. For tubes with template resulting from the pre-selection and selection cultures, transfer 0.5 µl per tube reverse primers 701_R and 702_R, respectively. See Table of Materials for sequences of 501_F - 505_F, and 701_R and 702_R.
      4. Transfer PCR tubes to the thermocycler and run the program from step 2.2.1.3.
    4. Mix and purify samples
      1. Measure concentrations using a dsDNA quantitation reagent according to manufacturer's instructions. Mix 100 ng of each PCR product into a single microcentrifuge tube.
      2. Prepare a 2% agarose gel with 0.2 µg/ml ethidium bromide (CAUTION).
      3. Add 6x gel loading dye to the mixed PCR products sample. Load the first lane of the gel with DNA ladder; load entire volume of the sample.
      4. Run gel at 100 V for 50 min. Visualize gel using a long-wavelength UV illuminator (CAUTION). Excise slice containing the PCR product at ~360 bp; transfer to microfuge tube. Gel slice can be stored at -20 °C.
      5. Following manufacturers' instructions, purify sample using a gel extraction kit and measure concentration using a dsDNA quantitation reagent. This is the final sample for high-throughput sequencing.
    5. Sequence on a high-throughput sequencing platform (see Table of Materials for platform used in this protocol).   
      1. Calculate sample concentration in nM as DNA concentration formula: ((ng/10³)/(bp*660))*10⁹, calculation method., where Static equilibrium diagram, ΣFx=0 equation, method of solving force balance in mechanical systems. is the concentration of the sample in ng/µl and Chromatography method, formula ΣFx=0, graph; DNA separation, spectroscopy setup, absorption analysis. is the sequence length of the sample DNA (~360 bp). Dilute sample to 4 nM in EB buffer.
      2. Follow manufacturer's instructions to denature sample and dilute to 9 pM in hybridization buffer.
      3. Load 600 µl of sample into reagent cartridge. Sequence following manufacturer's instructions and on-screen prompts.
  2. Analysis of sequencing data
    1. Download FLASh (Fast Length Adjustment of Short reads)20, place into folder along with fastq.gz files obtained from sequencing.
    2. Use FLASh to join the fastq.gz files corresponding to the paired-end reads for each pair of indices (forward and reverse reads for each NNS sub-library group for the pre-selection and selection cultures).
      1. Open Command Prompt and change directory to folder in protocol step 4.2.1. Join each pair of reads using command: flash , where mates1.fastq.gz and mates2.fastq.gz are the files containing the forward and reverse reads, respectively.
    3. After joining each pair of reads, place the out.extendedFrags.fastq output file into separate folders for results from the pre-selection or selection cultures. Rename the out.extendedFrags.fastq output file according to the NNS sub-library group to which it corresponds (i.e., 1.fastq, 2.fastq, etc.).
    4. Run the computational script NNS_DataAnalyzer.m (See Supplementary Code File) from each folder to compute the counts for each single amino acid mutation, and the counts for the wild-type, for each NNS sub-library group.
    5. Calculate the fitness effect Static equilibrium equation, ΣFiα=0, vector diagram, educational physics concept. of each mutation Static equilibrium; ΣFx=0; diagram, forces balanced, mechanical analysis, physics concept. at each position Static equilibrium; ΣFx=0, ΣFy=0 on particle; vector forces diagram; engineering analysis. as the base ten logarithm of the ratio of counts obtained in the selection (Static equilibrium concept, equation Nai; diagram for educational physics analysis.) versus the pre-selection (Static equilibrium, equation ΣFx=0, mathematical formula for education, physics equation diagram.) condition, relative to the wild-type:
         Static equilibrium equation, formula, showing logarithmic ratios, educational math diagram. .

Access restricted. Please log in or start a trial to view this content.

Results

The plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites (pBR322_OP1 - pBR322_OP5) is shown in Figure 2A. To test whether the orthogonal primers are specific, PCRs were performed using each pair of orthogonal primers individually, along with all five pBR322_OP1-5 plasmids, or with all plasmids minus the plasmid matching the orthogonal primer pair. The correct product was only obtained when the matching plasmid was included, and no product ...

Access restricted. Please log in or start a trial to view this content.

Discussion

Here a protocol is described for performing the functional assessment of whole-protein saturation mutagenesis libraries, using high-throughput sequencing technology. An important aspect of the method is the use of orthogonal primers during the cloning process. Briefly, each amino acid position is randomized by mutagenic PCR, and mixed together into groups of positions whose combined sequence length is accommodated by high-throughput sequencing. These groups are cloned into plasmid vectors containing pairs of orthogonal p...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare they have no competing financial interests

Acknowledgements

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
TyptoneResearch Products Intl. Corp.T60060-1000.0
Yeast extractResearch Products Intl. Corp.Y20020-500.0
Sodium chlorideFisher ScientificBP358-212
Potassium chlorideSigma-AldrichP9333-500G
Magnesium sulfateSigma-AldrichM7506-500G
AgarFisher ScientificBP1423-500
Tetracycline hydrochlorideSigma-AldrichT7660-5G
Petri platesCorning351029
MATLAB Mathworkshttp://www.mathworks.com/products/matlab/
Oligonucleotide primersIntegrated DNA Technologieshttps://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos25 nmol scale, standard desalting
pBR322_AvrIIavailable upon requestpBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene
pBR322_OP1 – pBR322_OP5available upon requestfive modified pBR322 plasmids each containing a pair of orthogonal priming sites
Q5 high-fidelity DNA polymeraseNew England BiolabsM0491Lincludes 5x PCR buffer and PCR additive (GC enhancer)
15 ml conical tubeCorning430025
Multichannel pipettes (Eppendorf ResearchPlus)Eppendorf
PCR plate, 96 wellFisher Scientific14230232
96 well plate sealExcel ScientificF-96-100
Veriti 96-well thermal cyclerApplied Biosystems4375786
6x gel loading dyeNew England BiolabsB7024S
AgaroseResearch Products Intl. Corp.20090-500.0
Ethidium bromideBio-Rad161-0433
UV transilluminator (FOTO/Analyst ImageTech)Fotodyne Inc.http://www.fotodyne.com/content/ImageTech_gel_documentation
EB bufferQiagen19086
96-well black-walled, clear bottom assay platesCorning3651
Lambda phage DNANew England BiolabsN3011S
PicoGreen dsDNA reagentInvitrogenP7581dsDNA quantitation reagent, used in protocol step 2.2.4
Victor 3 V microplate readerPerkinElmer
DNA purification kitZymo ResearchD4003
Microcentrifuge tubesCorning3621
Long-wavelength UV illuminatorFisher ScientificFBUVLS-80
Agarose gel DNA extraction bufferZymo ResearchD4001-1-100
AatIINew England BiolabsR0117S
AvrIINew England BiolabsR0174L
T4 DNA ligaseNew England BiolabsM0202S
EVB100 electrocompetent E. coliAvidityEVB100
Electroporator (E. coli Pulser)Bio-Rad1652102
Electroporation cuvettesBio-Rad165-2089
Spectrophotometer (Ultrospec 3100 pro)Amersham Biosciences80211237
50 ml conical tubesCorning430828
Plasmid purification kitMacherey-Nagel740588.25
8 well PCR strip tubesAxygen321-10-551
Qubit dsDNA HS assay kitInvitrogenQ32854dsDNA quantitation reagent
Qubit assay tubesInvitrogenQ32856
Qubit fluorometerInvitrogenQ32866
Ampicillin sodium saltAkron Biotechnology50824296
MiSeq reagent kit v2 (500 cycles)IlluminaMS-102-2003
MiSeq desktop sequencerIlluminahttp://www.illumina.com/systems/miseq.htmlalternatively, one could sequence on Illumina HiSeq platform
FLASh softwareJohn Hopkins University - open sourcehttp://ccb.jhu.edu/software/FLASH/software to merge paired-end reads from next-generation sequencing data
AatII_FGATAATAATGGTTTCTTAGACG
TCAGGTGGC
AvrII_RCTTCACCTAGGTCCTTTTAAAT
TAAAAATGAAG
AvrII_FCTTCATTTTTAATTTAAAAGGA
CCTAGGTGAAG
AatII_OP1_RACCTGACGTCCGTATTTCAAC
TGTCCGGTCTAAGAAACCATT
ATTATCATGACATTAAC
AatII_OP2_RACCTGACGTCCGCTCACGGA
GTGTACTAATTAAGAAACCATT
ATTATCATGACATTAAC
AatII_OP3_RACCTGACGTCGTACGTCTGA
ACTTGGGACTTAAGAAACCA
TTATTATCATGACATTAAC
AatII_OP4_RACCTGACGTCCCGTTCTCGAT
ACCAAGTGATAAGAAACCATT
ATTATCATGACATTAAC
AatII_OP5_RACCTGACGTCGTCCGTCGGA
GTAACAATCTTAAGAAACCAT
TATTATCATGACATTAAC
OP1_FGACCGGACAGTTGAAATACG
OP1_RCGACGTACAGGACAATTTCC
OP2_FATTAGTACACTCCGTGAGCG
OP2_RAGTATTAGGCGTCAAGGTCC
OP3_FAGTCCCAAGTTCAGACGTAC
OP3_RGAAAAGTCCCAATGAGTGCC
OP4_FTCACTTGGTATCGAGAACGG
OP4_RTATCACGGAAGGACTCAACG
OP5_FAGATTGTTACTCCGACGGAC
OP5_RTATAACAGGCTGCTGAGACC
Group1_FACACTCTTTCCCTACACGAC
GCTCTTCCGATCTNNNNNGC
ATTTTGCCTACCGGTTTTTGC
Group1_RGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNTC
TTGCCCGGCGTCAAC
Group2_FACACTCTTTCCCTACACGAC
GCTCTTCCGATCTNNNNNGA
ACGTTTTCCAATGATGAGCAC
Group2_RGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNGT
CCTCCGATCGTTGTCAGAAG
Group3_FACACTCTTTCCCTACACGAC
GCTCTTCCGATCTNNNNNAG
TAAGAGAATTATGCAGTGCTGCC
Group3_RGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNTC
GCCAGTTAATAGTTTGCGC
Group4_FACACTCTTTCCCTACACGAC
GCTCTTCCGATCTNNNNNCC
AAACGACGAGCGTGACAC
Group4_RGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNGC
AATGATACCGCGAGACCC
Group5_FACACTCTTTCCCTACACGAC
GCTCTTCCGATCTNNNNNCG
GCTGGCTGGTTTATTGC
Group5_RGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNTAT
ATGAGTAAACTTGGTCTGACAG
501_FAATGATACGGCGACCACCGA
GATCTACACTATAGCCTACAC
TCTTTCCCTACACGAC
502_FAATGATACGGCGACCACCGA
GATCTACACATAGAGGCACA
CTCTTTCCCTACACGAC
503_FAATGATACGGCGACCACCGA
GATCTACACCCTATCCTACAC
TCTTTCCCTACACGAC
504_FAATGATACGGCGACCACCGA
GATCTACACGGCTCTGAACA
CTCTTTCCCTACACGAC
505_FAATGATACGGCGACCACCGA
GATCTACACAGGCGAAGACA
CTCTTTCCCTACACGAC
701_RCAAGCAGAAGACGGCATAC
GAGATCGAGTAATGTGACTG
GAGTTCAGACGTG
702_RCAAGCAGAAGACGGCATAC
GAGATTCTCCGGAGTGACTG
GAGTTCAGACGTG

References

  1. Hutchison, C. A. 3rd, et al. Mutagenesis at a specific position in a DNA sequence. J Biol Chem. 253 (18), 6551-6560 (1978).
  2. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  3. Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. Site-directed mutagenesis in one day with >80% efficiency. Strategies. 9 (3), 3-4 (1996).
  4. Higuchi, R., Krummel, B., Saiki, R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16 (15), 7351-7367 (1988).
  5. Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. Systematic mutation of bacteriophage T4 lysozyme. J Mol Biol. 222 (1), 67-88 (1991).
  6. Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence. J Mol Biol. 240 (5), 421-433 (1994).
  7. Kleina, L. G., Miller, J. H. Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors. J Mol Biol. 212 (2), 295-318 (1990).
  8. Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. Amino acid sequence determinants of beta-lactamase structure and activity. J Mol Biol. 258 (4), 688-703 (1996).
  9. Fowler, D. M., et al. High-resolution mapping of protein sequence-function relationships. Nat Methods. 7 (9), 741-746 (2010).
  10. Hietpas, R. T., Jensen, J. D., Bolon, D. N. Experimental illumination of a fitness landscape. Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).
  11. McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. The spatial architecture of protein function and adaptation. Nature. 491 (7422), 138-142 (2012).
  12. Deng, Z., et al. Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution. J Mol Biol. 424 (3-4), 150-167 (2012).
  13. Stiffler, M. A., Hekstra, D. R., Ranganathan, R. Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase. Cell. 160 (5), 882-892 (2015).
  14. Matagne, A., Lamotte-Brasseur, J., Frere, J. M. Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem J. 330 (Pt2), 581-598 (1998).
  15. Salverda, M. L., De Visser, J. A., Barlow, M. Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).
  16. Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. Darwinian evolution can follow only very few mutational paths to fitter proteins. Science. 312 (5770), 111-114 (2006).
  17. Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. Ampicillin levels in sputum, serum, and saliva. Thorax. 25 (3), 304-311 (1970).
  18. Giachetto, G., et al. Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia. Pediatr Infect Dis J. 23 (7), 625-629 (2004).
  19. Ambler, R. P., et al. A standard numbering scheme for the class A beta-lactamases. Biochem J. 276 (Pt 1), 269-270 (1991).
  20. Magoc, T., Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies). Bioinformatics. 27 (21), 2957-2963 (2011).
  21. Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein. RNA. 19 (11), 1537-1551 (2013).
  22. Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. A systematic survey of an intragenic epistatic landscape. Mol Biol Evol. 32 (1), 229-238 (2015).
  23. Dove, S. L., Joung, J. K., Hochschild, A. Activation of prokaryotic transcription through arbitrary protein-protein contacts. Nature. 386 (6625), 627-630 (1997).
  24. Romero, P. A., Tran, T. M., Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Protein Fitness AssessmentTEM-1 Beta-LactamaseSite-Directed MutagenesisLibrary ConstructionAntibiotic SelectionDeep Sequencing AnalysisOrthogonal PrimersPlasmid Transformation