Cellular senescence, the irreversible state of cell-cycle arrest, can be induced by various cellular stresses. Here, we describe protocols to induce cellular senescence and methods to assess markers of senescence.
Method Article
Cellular senescence, the irreversible state of cell-cycle arrest, can be induced by various cellular stresses. Here, we describe protocols to induce cellular senescence and methods to assess markers of senescence.
In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed cellular senescence. Accumulation of senescent cells occurs with organismal aging and through continual culturing in vitro. Senescent cells influence many biological processes, including embryonic development, tissue repair and regeneration, tumor suppression, and aging. Hallmarks of senescent cells include, but are not limited to, increased senescence-associated β-galactosidase activity (SA-β-gal); p16INK4A, p53, and p21 levels; higher levels of DNA damage, including γ-H2AX; the formation of Senescence-associated Heterochromatin Foci (SAHF); and the acquisition of a Senescence-associated Secretory Phenotype (SASP), a phenomenon characterized by the secretion of a number of pro-inflammatory cytokines and signaling molecules. Here, we describe protocols for both replicative and DNA damage-induced senescence in cultured cells. In addition, we highlight techniques to monitor the senescent phenotype using several senescence-associated markers, including SA-β-gal, γ-H2AX and SAHF staining, and to quantify protein and mRNA levels of cell cycle regulators and SASP factors. These methods can be applied to the assessment of senescence in various models and tissues.
Over half a century ago, Hayflick and colleagues described how untransformed cells proliferate in culture, but for only a finite period of time1. Long-term culturing of human fibroblasts caused the cells to stop proliferating; however, they were metabolically active, and this was called cellular senescence. Senescence can be beneficial for inhibiting tumorigenesis, but it also can be detrimental, as it is thought to contribute to the loss of regenerative capacity that occurs with aging2,3. Senescent cells have been shown to accumulate in tissues as humans age4 and have been implicated in a number of biological processes, including embryonic development, wound healing, tissue repair, and age-related inflammation2.
Continual passaging of cells in culture induces replicative senescence, which has been linked to telomere attrition and genomic instability. Various cell stresses, including DNA damage and oncogenes, can also cause senescence3. Senescence caused by factors other than telomere attrition is often called stress-induced or premature senescence and generally depends on the p16INK4A/Rb pathway5. Although proliferating, untransformed cells typically appear spindle in shape, senescent cells can be identified as having certain characteristics, including a flat, large morphology and increased senescence-associated β-galactosidase activity (SA-β-gal) (Figures 1 & 2). Senescent cells also accumulate DNA damage markers, including γ-H2AX (Figure 3)6, and, potentially, senescence-associated heterochromatin foci (SAHF) (Figure 4)7. Senescent cells have higher levels of cell cycle regulators, including p16 (p16INK4A) and/or p21 and p53 (Figure 5)8,9. Moreover, recent data have shown that senescent cells can have non-autonomous effects by secreting a number of pro-inflammatory cytokines and chemokines called the senescence-associated secretory phenotype (SASP)10. Although this SASP phenomenon may vary from cell type to cell type, in general, it is demonstrated by an increase in Interleukin-6 (IL-6), IL-8, granulocyte-macrophage colony stimulating factor (GM-CSF), growth-regulated oncogene α (GRO-α), and GRO-β, among others (Figure 6). The particular stress or damage that induces senescence may also influence the secretory phenotype11,12,13. SASP can be detected by measuring the levels of secreted proteins using ELISAs or cytokine/protein arrays10,14. Although post-transcriptional mechanisms can regulate SASP protein levels11,15,16,17, changes in mRNA levels can also be detected in many cases. These changes are generally more sensitive and easier to quantify than protein level measurements. Other senescent markers can also be assessed, including persistent DNA damage nuclear foci, called DNA segments with chromatin alterations reinforcing senescence (DNA-SCARS)18, and various other markers3,19,20.
Here, we describe common techniques for inducing senescence in cells in culture and also for measuring several markers of senescence, including SA-β-Gal, γ-H2AX, SAHF, and the protein and mRNA of senescence-associated molecules.
1. Inducing Replicative Senescence
2. DNA Damage-induced Senescence
3. Staining Cells for Senescence-associated β-Galactosidase
4. Staining Cells for γ-H2AX
5. Staining Cells for SAHF Markers
NOTE: Human senescent cells will often have nuclear regions of condensed DNA/chromatin. In senescent cells, these heterochromatic regions are thought to inhibit the expression of proliferation-promoting genes, such as E2F family members. SAHF can be visualized by the reorganization of DAPI; by the presence of heterochromatin-associated histone marks, including the di- and tri-methylation of Lys9 on Histone H3 (H3K9Me2 and H3K9Me3); and by chromatin-reorganizing proteins, including HP-1 heterochromatin protein 1 (HP1), HIRA (histone repressor A), and ASF1a (anti-silencing function-1a) to chromatin30. We have chosen to use an oncogene-induced senescence model (OIS), as SAHF is more prominent in OIS models30. IDH4 cells proliferate in the presence of dexamethasone due to the presence of SV40 large T antigen but become senescent after the removal of dexamethasone from the medium31. SAHF can be detected by DAPI staining and by staining with antibodies against the specific markers listed above. Here, we describe DAPI and H3K9Me2 staining for the visualization of SAHF in cells28.
6. Analyzing Senescence-associated Proteins by Immunoblotting
NOTE: The senescent phenotype is characterized by the upregulation of cell cycle regulators, including p16INK4A, p21, and p53. This protocol will describe the quantification of the levels of these proteins in cell lysates. These techniques can be used to assess senescence induced using a variety of methods21,28,29.
7. Analyzing the mRNA Levels of Senescence Markers
NOTE: When isolating RNA, ensure that the work surfaces are cleaned with RNase removal solutions or an equivalent and that the materials are all RNase-free.
8. Quantifying SASP Protein Levels
Figures 2 - 6 show representative results from SA-β-gal staining; staining for γ-H2AX and SAHF; assessment of protein levels of p16INK4A, p21, and p53; and mRNA and protein levels of senescent-associated molecules. Increased SA-β-gal staining occurs with replicative and DNA damage-induced senescence. Also, observe the morphological changes that occur with senescence. Cells become enlarged and flat compared to the spindle appearance of proliferating fibroblasts. For this experimental paradigm, cells were stained and RNA/protein were isolated 7 d after IR exposure. More robust results may occur by waiting longer after IR exposure (i.e. 10 d). Conditions need to be determined for each condition and experimental setup. These results are representative and these markers can also be detected when senescence is induced using other methods.
For Figure 6, gene names are listed and correspond to CXCL1 (GROα), CXCL2 (GROβ), and CSF2 (GM-CSF). The upregulation of mRNA levels of some, but not all, of the SASP factors were observed after IR-induced senescence in WI-38 cells. Other senescence-associated mRNAs, including CDKN1A (encodes p21) and CDKN2A (encodes p16INK4A), were upregulated. Other mRNAs (EDN1 and ANKRD1) have also been included and have previously been shown to be higher in senescent cells15. Primers are listed in Table 1.

Figure 1: Proliferating and Senescent Fibroblasts. A schematic representation of proliferating (left) and senescent (right) fibroblasts. Examples of senescence inducers are shown in the yellow box. Senescence is associated with higher levels of the indicated markers. SA-β-gal, senescence-associated β-galactosidase activity; SASP, senescence-associated secretory phenotype; SAHF, senescence-associated heterochromatin foci; DDR, DNA-damage response. Please click here to view a larger version of this figure

Figure 2. Morphological Characteristics and Increased SA-β-gal Activity of Senescent Cells. WI-38 cells, either proliferating "young" (PDL 27), replicative senescent (PDL 40), or those exposed to ionizing radiation (IR), were stained for SA-β-gal activity. IMR-90 cells, either proliferating "young" (PDL 30), replicative senescent (PDL 52), or those exposed to ionizing radiation (IR), were stained for SA-β-gal activity. Sections 1 - 2 describe inducing replicative and DNA damage-induced senescence, and Section 3 explains staining for SA-β-gal. Cells were stained 7 d after IR. Con, control. Scale bar = 50 µm. Please click here to view a larger version of this figure.

Figure 3. Increased γ-H2AX Foci in Senescent Cells. WI-38 cells, either proliferating "young" (PDL 30) or replicative senescent (PDL 53), were fixed and stained with anti-γ-H2AX antibodies and DAPI. Note the increase in the number of γ-H2AX foci in senescent cells. Images were obtained on a confocal microscope. Z-sections were taken, and the maximum intensity projection was used to obtain a single plane image to visualize all detectable foci. Scale bar = 20 µm. Please click here to view a larger version of this figure.

Figure 4. Fluorescent Staining of SAHF in Senescent Cells. (A) Proliferating WI-38 cells (PDL 27) were untreated or exposed to ionizing radiation (IR). After 10 days, the cells were stained with DAPI to visualize SAHF (note dense/punctate DAPI staining in IR-treated cells) (B) IDH4 were grown in the presence of dexamethasone (proliferating) or in charcoal-stripped FBS to induce senescence (senescent). After 10 d, the cells were stained with antibodies against H3K9Me2 and DAPI. Images were obtained on a confocal microscope. Z-sections were taken, and the maximum-intensity projection was used to obtain a single-plane image. Proliferating cells in (A) and (B) have diffuse DAPI staining, whereas senescent cells have punctate DAPI staining. In (B), control cells have diffuse, very light staining for H3K9Me2, whereas H3K9Me2 staining is more robust and colocalizes with DAPI-stained foci in senescent cells. Scale bar = 20 µm. Please click here to view a larger version of this figure.

Figure 5. Quantification of Senescence-associated Proteins. Protein was isolated from either proliferating "young" (PDL 30) IMR-90 cells (-) or IMR-90 cells that were exposed to 10 Gy of ionizing radiation (IR). The medium was changed every 48 h and the cells were lysed 7 d after IR. Samples were analyzed by SDS-PAGE, immunoblotted with anti-p16INK4A antibodies, and re-probed with anti-p21 and then anti-p53 antibodies. GAPDH was used as a protein loading control. Please click here to view a larger version of this figure.

Figure 6. Quantification of Senescence-associated mRNAs and SASP Proteins. (A) RNA was isolated from either proliferating "young" (PDL 27 or 34) WI-38 cells (-) or WI-38 cells that were exposed to 10 Gy of ionizing radiation (IR). The medium was changed every 48 h and RNA isolation was performed 7 d after IR. RT-qPCR was used to quantify the levels of the indicated senescence-associated mRNAs using the gene-specific primers listed in Table 1. 18S levels were used for normalization. The histograms represent the mean normalized to untreated ±SEM from 5 independent experiments. (B) WI-38 cells (PDL 26) were exposed to 10 Gy of IR; 10 d later, the medium was changed to serum-free medium (see Section 7). After 24 h, conditioned medium was collected and IL-6, IL-8, and GROα levels were quantified using ELISA assays. The histogram represents the mean ±SEM from 3 experiments. * P < 0.05 and *** P < 0.001 by Student's t-test. Please click here to view a larger version of this figure.
| Human Primers | Forward | Reverse |
| 18S | CCCTATCAACTTTCGATGGTAGTCG | CCAATGGATCCTCGTTAAAGGATTT |
| ANKRD1 | AGT AGA GGA ACT GGT CACTGG | TGG GCT AGA AGT GTCTTC AGA T |
| CDKN1A (p21) | GAC ACCACT GGA GGG TGA CT | CAGGTC CAC ATG GTC TTC CT |
| CDKN2A (p16) | CCAACGCACCGAATAGTTACG | GCGCTGCCCATCATCATG |
| CSF2 (GM-CSF) | GGCCCCTTGACCATGATG | TCTGGGTTGCACAGGAAGTTT |
| CXCL1 | GAAAGCTTGCCTCAATCCTG | CACCAGTGAGCTTCCTCCTC |
| CXCL2 | AACTGCGCTGCCAGTGCT | CCCATTCTTGAGTGTGGCTA |
| EDN1 | CAG CAGTCT TAG GCG CTG AG | ACTCTT TAT CCA TCA GGG ACG AG |
| IL6 | CCGGGAACGAAAGAGAAGCT | GCGCTTGTGGAGAAGGAGTT |
| IL7 | CTCCAGTTGCGGTCATCATG | GAGGAAGTCCAAAGATATACCTAAAAGAA |
| IL8 | CTTTCCACCCCAAATTTATCAAAG | CAGACAGAGCTCTCTTCCATCAGA |
Table 1: RT-qPCR Primers for Senescence-associated mRNAs. Forward and reverse primers for RT-qPCR using SYBR-green technology are indicated.
Here, we have described methods for replicative and DNA-damage induced senescence using human diploid fibroblasts. In addition, techniques for quantifying protein and mRNA levels of various senescence-associated proteins are included, as well as staining for SA-β-gal and for the DNA-damage marker γ-H2AX. These protocols can be widely used to assess senescent phenotypes both in vitro and in vivo, although many caveats exist for characterizing senescence in vivo20. Other cells may express senescent markers, even if they are not senescent cells. For example, cells such as osteoclasts and macrophages have higher levels of β-gal activity32,33. In addition, many cancer cells have upregulated p16INK4A 34. Cells can also accumulate DNA damage (e.g., γ-H2AX foci) and not be senescent. SASP factors can also be upregulated by various normal physiological or pathological conditions that may or may not involve senescent cells. Therefore, multiple senescence markers should be utilized, especially when assessing senescence in vivo.
Although senescent cells were found to be increased in normal aging tissues more than 20 years ago4, it is only now that we are fully appreciating the plethora of roles that senescent cells play in both normal tissue homeostasis and in pathological conditions. The recent employment of mouse models to eliminate p16INK4A-positive senescent cells has allowed researchers to more clearly and precisely appreciate the role of senescent cells in tissues and organs35,36,37. These models have uncovered that senescent cells contribute to a multitude of age-related pathologies, tumorigenesis, and mouse lifespan35,36,37. Given these recent discoveries and the validation of the importance of senescent cells in physiology, the time is ripe for more research on these specific cells. For example, studies employing strategies to therapeutically remove senescent cells or to delay senescence could be beneficial for both healthspan and lifespan studies.
Recently, our laboratory found that metformin, a drug commonly used to treat type 2 diabetes mellitus, decreases cellular senescence38. As metformin is currently being proposed as an anti-aging therapy and has anti-cancer properties39,40, it will be interesting in the future to explore whether this drug, or other aging interventions, affect health outcomes by modulating cellular senescence.
The protocols we discuss here are common and widely accepted techniques to assess the senescent phenotype. For cells grown in vitro, it is critical to monitor cell changes from a spindle-like to a flattened morphology in order to ensure that the cells are senescent (See Figures 1 & 2). If cells are not positive for SA-β-gal or other markers described here, assess senescence at higher cell PDLs (for replicative senescence) or at an increased time after DNA damage-induced senescence. In addition, these protocols may need to be optimized for different cell types. For assessing SASP protein levels, it is critical to remove the serum from the cell medium, as this will cause high background levels in the ELISA or protein arrays. Therefore, keep this in mind when designing experiments, as it may not be ideal for simultaneously assessing multiple markers.
Staining for SA-β-gal, as described here, is limited by the fact that it requires the fixation of the cells. In addition, cell confluence has been shown to influence SA-β-gal activity. Protocols have been developed to assess SA-β-Gal activity using a fluorogenic substrate for β-gal activity, which allows for the quantification of this marker in live cells using flow cytometry41,42,43. SA-β-gal activity can also be measured in cell lysates using a chemiluminescent method44. In addition, γ-H2AX can also be measured using various other methods, including flow cytometry or the immunoblotting of cell lysates45.
It should be noted that SAHF formation is cell-line dependent and is mostly associated with oncogene-induced senescence20,30,46. Therefore, SAHF may not be present in all senescence models. The utility of SAHF as a senescent marker in mouse models may also be limited by the fact that SAHF is generally not observed in mouse senescent cells30,46,47. Here, antibodies against H3K9Me2 were used, but other molecular markers of SAHF can be used, including macroH2A, high mobility group A (HMGA) proteins, and tri-methylated lysine 9 histone H3 (H3K9Me3) and bound HP1 proteins. In addition, chromatin immunoprecipitation assays can be used to assess histone marks or the association of chromatin binding proteins to E2F target genes.
One should be aware that there are various limitations to characterizing senescence, including heterogeneity for markers and the fact that these markers are not expressed exclusively in senescent cells. Multiple (in general, 2 - 3) markers should be employed to assess senescence, including markers not described here. For example, DNA-SCARS, telomere damage, and/or DNA damage signaling can also be quantified. Furthermore, as senescence and, in particular, the SASP phenotype, has recently been shown to be affected by the specific stressor or damage that induces senescence11,12,13, it is important to assess multiple markers in each experimental paradigm.
The authors have nothing to disclose.
This study was supported by the Intramural Research Program of the National Institutes of Health, National Institute on Aging. The authors wish to thank Myriam Gorospe and Kotb Abdelmohsen for many helpful discussions about senescence and Kotb Abdelmohsen for also critically reading the manuscript. We also thank our laboratory members, especially Douglas Dluzen for critically reading the manuscript.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 16% Tris-glycine gels | Invitrogen | XP00160BOX | |
| Acid-Phenol ChCl3 | Ambion | AM9720 | |
| Alexa-Fluor 568 goat anti-mouse antibody | Invitrogen | A11031 | 1:300 dilution |
| Cell lifters | Corning Inc. | 3008 | Cell scraper |
| ECL anti-mouse HRP linked antibody | Amersham | NA931V | |
| ECL Plus Western Blotting Substrate | Pierce | 32132 | ECL |
| DAPI | Molecular Probes | MP01306 | stock 5 mg/mL in dH2O |
| GAPDH antibody | Santa Cruz | sc-32233 | 1:1,000 - 5,000 dilution |
| GlycoBlue | Ambion | AM9515 | |
| Histone H3 dimethyl K9 monoclonal antibody | Abcam | 1220 | 1:500 dilution |
| Human IL-6 Quantikine ELISA assay | R&D systems | D6050 | |
| Human IL-8 Quantikine ELISA assay | R&D systems | D8000C | |
| Human GROa Quantikine ELISA assay | R&D systems | DRG00 | |
| N-N-dimethylformamide | Sigma | D4551 | DMF |
| p16 monoclonal antibody | BD Biosciences | 51-1325gr | 1:500 dilution |
| p21 monoclonal antibody | Millipore | 05-345 | 1:750 dilution |
| p53 monoclonal antibody | Santa Cruz | sc-126 | 1:500 dilution clone DO-1 |
| phospho-H2AX (Ser139) FITC conjugate antibody | Cell Signaling | 9719 | 1:2,000 dilution |
| POWER SYBR-green PCR master mix | Applied Biosystems | 4367659 | |
| Pre-stained molecular weight markers | Biorad | 161-0374 | |
| ProLong Gold Antifade | Invitrogen | P36930 | |
| PVDF membrane | Thermo Scientific | 88518 | |
| Senescence β-Galactosidase Staining Kit | Cell Signaling | 9860 | |
| TRIzol | Ambion/Life Tech | 10296028 |
Request permission to reuse the text or figures of this JoVE article
Request Permission