Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Summary

Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Abstract

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis is an obligate pathogen that causes fatal inhalational anthrax. Bacillus cereus is considered a useful model for studying B. anthracis due to its close evolutionary relationship. The gene cluster ba1554 - ba1558 of B. anthracis is highly conserved with the bc1531- bc1535 cluster in B. cereus, as well as with the bt1364-bt1368 cluster in Bacillus thuringiensis, indicating the critical role of the associated genes in the Bacillus genus. This manuscript describes methods to prepare and characterize a protein product of the first gene (ba1554) from the gene cluster in B. anthracis using a recombinant protein of its ortholog in B. cereus, bc1531.

Introduction

Recombinant protein expression is widely used to overcome problems associated with natural protein sources, such as limited protein quantities and harmful contamination. Moreover, in studies of pathogenic genes and proteins, an alternative laboratory strain that does not require additional safety precautions can be utilized. For example, Bacillus cereus is a useful model for studying Bacillus anthracis due to their close evolutionary relationship¹.

B. anthracis is an obligate pathogen that causes fatal inhalational anthrax in humans and livestock and can potentially be used as a bioweapon

Protocol

1. Recombinant Protein Production and Purification of rBC1531

1. Preparation of a recombinant BC1531 protein (rBC1531)-expression plasmid
   1. Prepare genomic DNA of B. cereus¹⁰.
   2. Amplify the bc1531 gene from a template of B. cereus genomic DNA by polymerase chain reaction (PCR), using forward and reverse primers (see the Materials List) to create BamHI and SalI restriction enzyme sites, respectively¹⁰.
   3. Digest the PCR product and a modified pET49b vector (pET49bm) using BamHI and SalI, as described

Results

Characterization of the protein of interest in this study began by preparing a sufficient quantity of recombinant B. cereus bc1531 (rBC1531) protein, preferably more than several milligrams. The DNA fragment encoding the BC1531 protein was prepared by PCR using the genomic DNA of B. cereus as a template, as it contains orthologous genes identical to ba1554. rBC1531 was overexpressed as a soluble protein in E. coli cells. The rBC1531 protein was expresse.......

Discussion

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Bacillus cereus ATCC14579	Korean Collection for Tissue Culture	3624
Genomic DNA prep kit	GeneAll	106-101	Genomic DNA preparation
Forward primer	Macrogen	GAAGGATCCGGAAGCAAAAA CGATGAAAGATATGCA	BamHI site is underlined
Reverse primer	Macrogen	CTTGTCGACTTATTCTTTCTCT CCCTCATCAATACGTG	SalI site is underlined
nPfu-Forte	Enzynomics	P410	PCR polymerase
BamHI	Enzynomics	R003S
SalI	Enzynomics	R009S
pET49b expression vector	Novagen	71463	Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase	Enzynomics	M001S
Dialysis memebrane	Thermofisher	18265017
Dry block heater	JSR	JSBL-02T
LB broth (Luria-Bertani)	LPS solution	LB-05
LB Agar, Miller (Luria-Bertani)	Becton, Dickinson and Company
Kanamycin	LPS solution	KAN025
Mini-prep kit	Favorgen	FAPDE300	Plasmid DNA preparation
BL21(DE3) Competent cell	Novagen	69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG)	Fisher BioReagents	50-213-378
Sodium chloride	Daejung	7548-4100	PBS material
Potassium chloride	Daejung	6566-4405	PBS material
Potassium phosphate	Bio Basic Inc	PB0445	PBS material
Sodium phosphate	Bio Basic Inc	S0404	PBS material
Imidazole	Bio Basic Inc	IB0277
Sonicator	Sonics	VCX 130
Ni-NTA agaros	Qiagen	30210	Nickel bead
Rotator	Finepcr	AG
Precision Plus Protein Dual Color Standards	Bio-rad	1610374	SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250	Fisher BioReagents	BP101-25	Coomassie staining solution
Methyl alcohol	Samchun chemical	M0585	Coomassie staining solution
Acetic acid	Daejung	1002-4105	Coomassie staining solution
Dialysis memebrane	Thermofisher	68035
2-Mercaptoethanol	Sigma-aldrich	M6250
Thrombin	Merckmillipore	605157-1KUCN	Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600	General Electric	28989335	Size exclusion chromatography
Gel filtration standard	Bio-rad	151-1901
Centrifugal filter	Amicon	UFC800396
Crystralization plates	Hampton research	HR3-083	96-well sitting drop plate
The JCSG core suite I-IV	Qiagen	130924-130927	Crystallization secreening solution
Microscope	Nikon	SMZ745T
Cryschem plates	Hampton research	HR3-158	24-well sitting drop plate
Inorganic pyrophosphatase	Sigma	10108987001
Ammonium molybdate solution	Sigma	13106-76-8
L-ascorbic acid	Sigma	50-81-7
NTP substrate	Startagene	200415-51
Spectrophotometer	Biotek	SynergyH1	microplate reader
GraphPad Prism 5	GraphPad	Prism 5 for Window