A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

27K views

DOI:

10.3791/55745

June 6th, 2017

* These authors contributed equally

In This Article

Summary

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

Abstract

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

Introduction

Transition through all the phases of the cell cycle is coupled to a tightly regulated gene expression program. This coordinated "on and off" of gene transcription throughout the cell cycle is believed to be under the control of complex transcriptional regulatory systems, regulating not just the timing but also the levels of gene expression. Deregulation of key cell cycle components is known to contribute to the development of several diseases and is a well- established hallmark of tumorigenesis1,2. Genome-wide transcriptomic analyses carried out in yeast and mammalian cells have revealed that a large n....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Cellular Synchronization, Release and Monitoring of Cell Cycle Progression

  1. Thymidine- and nocodazole-based (Thy-Noc) synchronization and release of U2OS cells from Mitosis
    1. Prepare required cell culture medium. U2OS cells are routinely grown in DMEM-Glutamine medium complemented with 10% (vol/vol) FBS (optional: 1% penicillin/streptomycin). Perform all the medium preparation and manipulation under sterile conditions and warm up complemented medium (from now on referred to as "complete medium") to 37 °C prior to use.
    2. Seed 2 x 106 U2OS cells per 100 mm dish in 10 mL complete culture medium. In....

Access restricted. Please log in or start a trial to view this content.

Results

Schematic representation of Thy-Noc and HU-based protocols for cell synchronization.

Figure 1 summarizes the steps required for U2OS cell synchronization and subsequent sample collection in order to verify progression through the cell cycle and to perform gene expression analyses.

Phospho-H3 and PI staining are good evaluation parameters to select synchroniz.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Analysis of fine-tune regulated genes involved in transient and specific roles in the cell cycle requires a uniform cell population. Many researchers routinely use long-established tumor cell lines for these purposes, and a variety of methods have been developed to obtain synchronous (or partially synchronous) cell populations, with the aim to accumulate as many cells as possible in defined cell cycle phases. Moreover, strong efforts have been undertaken to improve and optimize well-established synchronization approaches.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank members of the Zubiaga and the Altmeyer laboratories for helpful discussions and for technical support. This work was supported by grants from the Spanish Ministry (SAF2015-67562-R, MINECO/FEDER, UE), the Basque Government (IT634-13 and KK-2015/89), and the University of the Basque Country UPV/EHU (UFI11/20).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
DMEM, high glucose, GutaMAX supplementThermo Fisher Scientific61965-059
FBS, qualified, E.U.-approved, South America originThermo Fisher Scientific10270-106
Penicillin-Streptomycin (10,000 U/mL)Thermo Fisher Scientific15140-122
0.25% Trypsin-EDTA (1x), phenol redThermo Fisher Scientific25200-072
ThymidineSIGMAT1895-5GFreshly prepared. Slight warming might help dissolve thymidine.
NocodazoleSIGMAM-1404Stock solution in DMSO stored at -20 ºC in small aliquots
HydroxyureaSIGMAH8627Freshly prepared
Mitomycin C from Streptomyces caespitosusSIGMAM42871.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxideSIGMAD2650
Propidium iodideSIGMAP4170Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6Home made
EthanolPANREACA3678,2500
ChloroformSIGMAC2432
Sodium CitratePANREAC131655
Triton X-100SIGMAT8787
RNAse AThermo Fisher ScientificEN0531
TRIzol ReagentLifeTechnologies15596018
RNeasy Mini kitQIAGEN74106
High-Capacity cDNA Reverse Transcription KitThermo Fisher Scientific4368814
Anti-Cyclin E1 antibodyCell Signaling41291:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibodyCell Signaling41351:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actinSIGMAA-54411:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antibotyMillipore06-570Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibodyInvitrogenR37116Specified in the protocol
Secondary anti-mouse-HRP antibodySanta Cruz Biotechnologysc-36971:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGABiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTCBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCTBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGABiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGACBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAGBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                    BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                    BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                 BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master MixThermo Fisher Scientific4368702
FACS Tubes Sarstedt551578
MicroAmp Optical 96-Well Reaction PlateThermo Fisher ScientificN8010560
Corning 100 mm TC-Treated Culture DishCorning
Corning Costar cell culture plates 6 wellCorning3506
Refrigerated Bench-Top MicrocentrifugeEppendorf5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12Jouan743205604
NanoDrop Lite SpectrophotometerThermo ScientificND-LITE-PR
BD FACSCalibur Flow CytometerBD Bioscience
QuantStudio 3 Real-Time PCR SystemThermo Fisher ScientificA28567

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101 (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9 (11), 785-797 (2009).
  3. Cho, ....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Cell Cycle SynchronizationHydroxyurea TreatmentThymidine NocodazoleFlow Cytometry AnalysisGene Expression AnalysisRNA Extraction ProtocolPropidium Iodide StainingU2OS CellsMitotic Cell ArrestG1 S Boundary