A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

26.9K views

DOI:

10.3791/55745

June 6th, 2017

* These authors contributed equally

In This Article

Summary

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

Abstract

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

Introduction

Transition through all the phases of the cell cycle is coupled to a tightly regulated gene expression program. This coordinated "on and off" of gene transcription throughout the cell cycle is believed to be under the control of complex transcriptional regulatory systems, regulating not just the timing but also the levels of gene expression. Deregulation of key cell cycle components is known to contribute to the development of several diseases and is a well- established hallmark of tumorigenesis1,2. Genome-wide transcriptomic analyses carried out in yeast and mammalian cells have revealed that a large number of genes exhibit periodic gene expression patterns in the cell cycle, suggesting that transcriptional fluctuation during the cell cycle is a reflection of the temporal requirement of a given gene product in a precise phase3,4,5.

A major task in the study of cell cycle-regulated gene expression is the synchronization of cells into specific cell cycle phases. Cell synchronization helps to interpret association of a gene expression pattern to a particular cell cycle phase transition, and it has led to a better understanding of the regulation and function of numerous genes. Cell synchronization is also important for studying the mechanism of action of anticancer drugs, as chemotherapeutic agents are known to affect both gene expression as well as cell cycle kinetics6,7. Nevertheless, it is often difficult to determine whether gene expression differences resulting from treatment with these agents are a direct response to the treatment or are merely the consequence of changes in cell cycle profiles. To distinguish between these possibilities, gene expression should be analyzed in cells that have been synchronized prior to addition of the chemotherapeutic drug.

With the exception of some primary cells such as freshly isolated lymphoid cells -which constitute a homogeneous cell population synchronized in G08-, in vitro established cell lines grow asynchronously in culture. Under regular growth conditions, these asynchronously cycling cells are found in all phases of the cell cycle but, preferentially in G19. Therefore, this context does not provide an optimal scenario for functional or gene expression analyses in a specific cell cycle phase (e.g. G1, S etc.). Non-transformed immortalized cell lines (e.g. fibroblasts) can be synchronized with so-called physiological methods10. These methods are based on the retained primary cell features of non-transformed cells, such as cell-contact inhibition and growth factor dependency in order to continue cycling. Removal of serum in combination with contact inhibition renders non-transformed cells arrested at G0/G1. However, synchronized cell cycle entry and progression often requires subculture, which also involves artificial detachment of the cells and re-plating10. Most importantly, this method is not suitable for synchronization of transformed cell lines, the vast majority of established cell lines presently in use, characterized for lacking cell contact-mediated growth inhibition or response to growth factor withdrawal. Thus, it is clear that alternative methods are required for efficient cell synchronization in specific phases of the cell cycle. In general terms, the most frequently used synchronization methods are based on transient chemical or pharmacological inhibition of one defined point of the cell cycle, typically DNA synthesis or mitotic spindle formation. Inhibition of DNA synthesis synchronizes cells by arresting them in late G1 or early S phase. This can be achieved by the addition of compounds such as mimosine, an inhibitor of nucleotide biosynthesis11,12, aphidicolin, an inhibitor of DNA polymerases13,14, hydroxyurea, an inhibitor of ribonucleotide reductase15,16 or by excess amounts of thymidine17,18. On the other hand, inhibitors of microtubule polymerization, such as colchicine or nocodazole, are able to block mitotic spindle formation leading to cell synchronization at early M phase19,20,21.

In this work we describe a method involving two complementary synchronization protocols based on transient chemical inhibition for studying the expression of cell cycle-regulated genes at the mRNA level. This method is fundamental for defining the role of cell cycle genes in specific cell cycle processes. Furthermore, it provides a general frame for studying the impact of anticancer treatments in order to accurately detect drug responsive genes and to minimize misinterpretations derived from perturbations in cell cycle progression generated by these drugs.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Cellular Synchronization, Release and Monitoring of Cell Cycle Progression

  1. Thymidine- and nocodazole-based (Thy-Noc) synchronization and release of U2OS cells from Mitosis
    1. Prepare required cell culture medium. U2OS cells are routinely grown in DMEM-Glutamine medium complemented with 10% (vol/vol) FBS (optional: 1% penicillin/streptomycin). Perform all the medium preparation and manipulation under sterile conditions and warm up complemented medium (from now on referred to as "complete medium") to 37 °C prior to use.
    2. Seed 2 x 106 U2OS cells per 100 mm dish in 10 mL complete culture medium. In order to calculate the number of dishes needed, take into account that each 100 mm dish typically provides enough mitotic cells to re-plate approximately 5 wells of a 6-well plate (0.2 - 0.25 x 106 cells/well) (see Figure 1B). Two wells per selected time point are required in the experiment (1 well for RNA extraction and 1 well for cell cycle monitoring). Additionally, a third well may be collected per time point for protein analysis.
      ​NOTE: Plate cells in the evening (around 7 pm) so that subsequent steps can be carried out during working hours the following days. Include 2 additional wells of asynchronously growing cells to define FACS analysis compensation settings.
    3. Let cells attach by incubating 100 mm dishes at 37 °C in a humidified atmosphere with 5% CO2 for 24 h.
    4. For the thymidine block, prepare a 200 mM thymidine stock solution by dissolving 145.2 mg thymidine powder in 3 mL H2O (or equivalent amounts) and sterilize the solution by filtration through a 0.2 µm pore size filter. Slight warming might help dissolve thymidine. Add 100 μL of the freshly prepared 200 mM stock to each 100 mm culture dish (final concentration 2 mM). Incubate cells with thymidine for 20 h at 37 °C in a humidified atmosphere with 5% CO2.
      ​NOTE: Treat cells in the evening (around 7 pm), to have time to perform both thymidine release and nocodazole block the following day.
    5. To release from the thymidine block, remove thymidine containing growth medium in the afternoon of the following day (3 pm); wash cells twice with pre-warmed 1x PBS and add 10 mL of complete medium to each 100 mm dish. Incubate cells for 5 h at 37 °C in a humidified atmosphere with 5% CO2.
    6. For mitotic cell arrest, add nocodazole to a final concentration of 50 ng/mL (8 pm). Prepare a stock solution by dissolving nocodazole powder in DMSO (e.g. 5 mg/mL) and store frozen at -20 °C. Incubate cells with nocodazole for no longer than 10 - 11 h at 37 °C in a humidified atmosphere with 5% CO2.
    7. Release from nocodazole-mediated arrest in early M phase (mitotic shake-off) and collection of samples at several time points (starting at 6-7 am).
      1. Detach rounded (mitotic) cells by shaking each plate and gently pipetting nocodazole-containing growth medium. Collect medium with detached cells from each 100 mm plate into 50 mL sterile tubes, centrifuge (300 x g, 5 min, room temperature (RT)) and wash cells twice by adding 1x  PBS followed by centrifugation. Use of cold PBS or PBS plus nocodazole is recommended to avoid mitotic slippage (see Discussion section).
      2. Resuspend mitotic cells gathered from each 100 mm plate in 10 mL of complete medium. Save 2 mL for RNA extraction and 2 mL for FACS analysis for the 0 h time point (approximately 0.2-0.25 x 106 cells per sample).
      3. Re-plate remaining mitotic cells for subsequent time points in 6-well plates (2 mL/well; 0.2-0.25 x 106 cells/well).
        NOTE: Remember that 2 wells are required per selected time point (1 for RNA and 1 for FACS analysis).
    8. Collect samples at selected time points. Every 1.5 to 3 h is recommended in order to obtain an adequate profile of the cell cycle progression.
      1. For RNA extraction, remove medium, rinse well with 2 mL pre-warm 1x PBS and add 1 mL of suitable RNA isolation reagent (e.g. TRIzol) in the well (perform this last step in a safety cabinet for chemicals). Pipette up and down to detach and lyse cells, transfer cell lysate to a 1.5 mL microcentrifuge tube, incubate 5 min at RT and store tube at -80 °C until further use.
      2. For FACS analysis, rinse well with 2 mL pre-warm 1x PBS, add pre-warmed Trypsin-EDTA solution (0.3 mL/well) to detach cells, block Trypsin-EDTA by adding 1 mL complete medium and collect each sample in a separate 15 mL tube.
        1. Centrifuge cells (300 x g, 5 min, RT), save cellular pellet and discard supernatant. In order to fix cells, resuspend cells in 1 mL of chilled 70% (v/v) ethanol in 1x PBS by gently vortexing tubes, and place them on ice for approximately 15 min prior to storing at 4 °C or to staining for further analysis by FACS (described in steps 1.4 - 1.5).
  2. HU-based synchronization and release of U2OS cells from G1/S boundary
    1. Prepare complete cell culture medium as described in step 1.1.
    2. Seed 0.25 x 106 U2OS cells per well in 6 well plates (2 mL complete culture medium per well). In order to calculate the number of wells needed for the experiment, take into account that 2 wells will be required per selected time point (1 well for RNA extraction and 1 well for cell cycle monitoring) and that 2 additional wells of asynchronously growing cells are needed to define FACS analysis compensation settings.
    3. Let cells attach by incubating 6-well plates overnight (O/N) at 37 °C in a humidified atmosphere with 5% CO2.
    4. Remove complete medium from wells the following morning and add 2 mL of pre-warmed FBS-free DMEM-Glutamine medium per well. Incubate cells for an additional 24 h at 37 °C in a humidified atmosphere with 5% CO2.
      ​NOTE: Perform this step in all wells except for 2 (those saved to define FACS settings). Serum withdrawal step can be omitted if efficient synchronization is achieved by simply incubating cells with HU.
    5. G1/S cell cycle arrest with HU.
      1. Prepare fresh HU stock solution (500 mM) prior to each use. Add 2 mL H2O to 76.06 mg of HU powder and mix until thoroughly dissolved. Sterilize the solution by filtration through a 0.2 µm pore size filter. Mix 50 mL of complete medium with 400 μL of filter-sterilized HU stock solution for a final HU concentration of 4 mM.
      2. Remove medium from all wells except from the 2 wells needed for defining FACS settings and replace with a freshly prepared 4 mM HU-containing complete medium (2 mL/well).
      3. Incubate cells for 24 h in HU-containing medium at 37 °C in a humidified atmosphere with 5% CO2.
    6. Release of cells from HU-mediated arrest. Remove HU-containing medium from wells and rinse wells twice with pre-warmed 1x PBS (2 mL each time). Add 2 mL of complete medium per well. Collect 2 samples for the 0 h time point (1 for RNA extraction and 1 for cell cycle arrest verification by FACS) as well as 2 samples saved for FACS settings. Place remaining wells in the incubator.
    7. Collect samples every 1.5 to 3 h in order to obtain an adequate distribution of cell cycle progression. At each time point, perform sample processing (for RNA extraction and for FACS analysis) as described in 1.1.8.1-1.1.8.2.
  3. Treatment with DNA damaging agents
    NOTE: Whenever the aim is to elucidate the effect of a compound (e.g. DNA damaging agents) in cell cycle events, any of the previously described synchronization methods can be combined with treatment of cells with the genotoxic agent. In order to select the synchronization method, it is important to consider the phase of the cell cycle that we would like to analyze. In general, Thy-Noc procedure may be suitable to study the effect of a compound in G1 phase or S phase entry while HU-mediated synchronization may be more suitable to study the impact in S to G2 phases or in the entry to mitosis.
    1. Analysis of the effect of genotoxic agents in G1 phase or S phase entry
      1. Synchronize cells as described in 1.1.2. to 1.1.6.
      2. Release cells from nocodazole and re-plate them as described in 1.1.7. Incubate them at 37 °C in a humidified atmosphere with 5% CO2 for 3 h to let them attach prior to adding agent (required incubation period may vary depending on the cell line).
      3. Add agent and collect samples as previously described in 1.1.8.
    2. Analysis of the effect of genotoxic agents in S-G2 phases or M entry
      1. Synchronize cells as described in 1.2.2. to 1.2.5.
      2. Release cells from HU as described in 1.2.6. and add agent straightaway.
      3. Collect samples as previously described in 1.8.
  4. Monitoring of cell synchronization and progression through the cell cycle by propidium iodide (PI) staining and FACS analysis
    NOTE: Samples collected at all time points together with those required to define FACS settings can be stored at 4 °C once they have been fixed (as mentioned in 1.1.8.2). Perform staining with PI solution followed by FACS analysis for all the samples of the experiment simultaneously. PI intercalates into the major groove of double-stranded DNA producing a highly fluorescent signal when excited at 535 nm with a broad emission peak around 600 nm. Since PI can also bind to double-stranded RNA, it is necessary to treat the cells with RNase for optimal DNA resolution.
    1. Prepare freshly made PI staining solution. A PI stock solution can be prepared by dissolving PI powder in PBS (e.g. 5 mg/mL). Store the stock solution at 4 °C (in darkness). Staining solution is composed of PI (140 μM), sodium citrate (38 mM) and Triton X-100 (0.01% v/v).
    2. Warm up an appropriate surface (e.g. oven) to 37 °C.
    3. Centrifuge fixed cells (450 x g, 5 min, RT), decant supernatant (ethanol) and wash once with 1x PBS.
    4. Centrifuge cells again, remove PBS and add 300 μL of PI staining solution per sample (except to one of the samples for FACS settings; add PBS to this sample instead).
    5. Transfer cells to FACS Tubes (5 mL round-bottom polystyrene tubes).
    6. Add 1 μL of RNase A to each sample, mix and incubate samples for 30 min in darkness at 37 °C. Samples can be stored protected from light at 4 °C for a maximum of 2 - 3 days.
    7. Analyze DNA content in samples by flow cytometry. Define FACS analysis compensation settings with PI-stained asynchronous sample. Use blank sample (without PI staining solution) to check for autofluorescence. Basics of PI staining-mediated analysis of DNA content by flow cytometry has been previously described9.
  5. Determination of mitotic index by double phospho-H3 (Ser 10)/PI staining
    NOTE: Cells undergoing mitosis can be easily detected by flow cytometry with antibodies specific for phospho-histone H3 in Serine 10 (pH3). A concomitant PI staining is useful to determine DNA content-based distribution of the cell population. 5 samples are required for the optimal configurations of FACS settings: blank, PI-only, pH3-only, secondary antibody-only and double staining.
    1. Centrifuge fixed cells (450 x g, 5 min, 4 °C) and discard supernatant. The following steps are described to perform staining in 15 mL tubes.
    2. Wash cells by adding 1 mL PBS-T (PBS + 0.05% Tween-20) to the pellet and centrifuge (450 x g, 5 min, 4 °C). Remove supernatant.
    3. Add anti-pH3 antibody diluted (1:500) in 100-200 µL of PBS-T + 3% BSA, and incubate with rocking for 2 h at RT (or O/N at 4 °C).
    4. Add 2 mL PBS-T (PBS + 0.05% Tween-20) and centrifuge (450 x g, 5 min, 4 °C). Remove supernatant.
    5. Wash once more by adding 2 mL PBS-T to the pellet, centrifuge and discard supernatant.
    6. Add secondary antibody (anti-rabbit AlexaFluor 488 in the case of selected pH3 antibody) diluted (1:500) in 100-200 µL of PBS-T + 3% BSA and incubate with rocking for 1 h at RT (or O/N at 4 °C). Protect samples from light.
    7. Wash twice with PBS-T (2 mL) by centrifugation as described in step 1.5.4.
    8. Perform PI staining as described (steps 1.4.1 to 1.4.6).

2. Sample Collection and Processsing for Gene Expression Analysis

  1. Take 1.5 mL microcentrifuge samples in the RNA isolation reagent out of the freezer and let them thaw at RT inside a safety cabinet for chemicals.
  2. Add 400 µL of chloroform to each sample and shake vigorously (but do not vortex) until complete mixing. Incubate samples for 5 min at RT.
  3. Centrifuge tubes for 15 min (≥8,000 x g, 4 °C) in a benchtop microcentrifuge.
  4. Transfer the aqueous (upper) phase to a new 1.5 mL microcentrifuge tube and register the transferred volume (in order to simplify the procedure, it is recommended to collect equal volumes in all samples of the experiment).
  5. Add 1 volume of 100% ethanol slowly (drop by drop) to the aqueous phase while mixing. Do not centrifuge.
  6. Perform the next steps with the commercial RNA mini prep kit. Pipet up to 700 µL of each sample, including any precipitate that may have formed, into a spin column in a 2 mL collection tube (provided by the manufacturer).
  7. Close the lid and centrifuge (≥ 8,000 g, RT) for 15 s. Discard the flow-through. Repeat previous step with the remaining sample (if any).
  8. Follow manufactures´ instructions for RNA washing and elution (elute each sample in 30 - 40 µl nuclease-free H2O in order to achieve an appropriate RNA concentration for next step).
  9. Determine RNA concentration and purity of samples by absorbance measurements (a A260/280 ratio of 2.0-2.1 indicates good purity of the RNA sample). Store RNA samples at -80 °C until use for RT-qPCR analysis.
  10. For RNA conversion into cDNA and subsequent quantitative-PCR, take 1 µg RNA per sample and prepare retrotranscriptase reaction according to manufacturers' instructions. Obtained cDNA samples can be stored at 4 °C (for a couple of days) or at -20 °C (for longer periods of time).
    NOTE: Sample preparation, primer design and other considerations for real time-PCR have been extensively described in the literature22,23.

Access restricted. Please log in or start a trial to view this content.

Results

Schematic representation of Thy-Noc and HU-based protocols for cell synchronization.

Figure 1 summarizes the steps required for U2OS cell synchronization and subsequent sample collection in order to verify progression through the cell cycle and to perform gene expression analyses.

Phospho-H3 and PI staining are good evaluation parameters to select synchroniz...

Access restricted. Please log in or start a trial to view this content.

Discussion

Analysis of fine-tune regulated genes involved in transient and specific roles in the cell cycle requires a uniform cell population. Many researchers routinely use long-established tumor cell lines for these purposes, and a variety of methods have been developed to obtain synchronous (or partially synchronous) cell populations, with the aim to accumulate as many cells as possible in defined cell cycle phases. Moreover, strong efforts have been undertaken to improve and optimize well-established synchronization approaches...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank members of the Zubiaga and the Altmeyer laboratories for helpful discussions and for technical support. This work was supported by grants from the Spanish Ministry (SAF2015-67562-R, MINECO/FEDER, UE), the Basque Government (IT634-13 and KK-2015/89), and the University of the Basque Country UPV/EHU (UFI11/20).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
DMEM, high glucose, GutaMAX supplementThermo Fisher Scientific61965-059
FBS, qualified, E.U.-approved, South America originThermo Fisher Scientific10270-106
Penicillin-Streptomycin (10,000 U/mL)Thermo Fisher Scientific15140-122
0.25% Trypsin-EDTA (1x), phenol redThermo Fisher Scientific25200-072
ThymidineSIGMAT1895-5GFreshly prepared. Slight warming might help dissolve thymidine.
NocodazoleSIGMAM-1404Stock solution in DMSO stored at -20 ºC in small aliquots
HydroxyureaSIGMAH8627Freshly prepared
Mitomycin C from Streptomyces caespitosusSIGMAM42871.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxideSIGMAD2650
Propidium iodideSIGMAP4170Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6Home made
EthanolPANREACA3678,2500
ChloroformSIGMAC2432
Sodium CitratePANREAC131655
Triton X-100SIGMAT8787
RNAse AThermo Fisher ScientificEN0531
TRIzol ReagentLifeTechnologies15596018
RNeasy Mini kitQIAGEN74106
High-Capacity cDNA Reverse Transcription KitThermo Fisher Scientific4368814
Anti-Cyclin E1 antibodyCell Signaling41291:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibodyCell Signaling41351:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actinSIGMAA-54411:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antibotyMillipore06-570Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibodyInvitrogenR37116Specified in the protocol
Secondary anti-mouse-HRP antibodySanta Cruz Biotechnologysc-36971:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGABiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTCBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCTBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGABiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGACBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAGBiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                    BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                    BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                 BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                BiolegioDesigned by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master MixThermo Fisher Scientific4368702
FACS Tubes Sarstedt551578
MicroAmp Optical 96-Well Reaction PlateThermo Fisher ScientificN8010560
Corning 100 mm TC-Treated Culture DishCorning
Corning Costar cell culture plates 6 wellCorning3506
Refrigerated Bench-Top MicrocentrifugeEppendorf5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12Jouan743205604
NanoDrop Lite SpectrophotometerThermo ScientificND-LITE-PR
BD FACSCalibur Flow CytometerBD Bioscience
QuantStudio 3 Real-Time PCR SystemThermo Fisher ScientificA28567

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101 (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9 (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27 (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41 (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24 (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4 (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11 (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7 (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41 (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186 (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11 (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275 (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42 (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242 (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. , (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126 (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91 (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1 (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39 (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9 (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217 (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23 (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20 (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5 (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13 (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140 (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30 (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372 (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23 (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289 (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246 (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29 (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12 (6), 865-877 (2013).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Cell Cycle SynchronizationHydroxyurea TreatmentThymidine NocodazoleFlow Cytometry AnalysisGene Expression AnalysisRNA Extraction ProtocolPropidium Iodide StainingU2OS CellsMitotic Cell ArrestG1 S Boundary