Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

Summary

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

Abstract

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

Introduction

Transition through all the phases of the cell cycle is coupled to a tightly regulated gene expression program. This coordinated "on and off" of gene transcription throughout the cell cycle is believed to be under the control of complex transcriptional regulatory systems, regulating not just the timing but also the levels of gene expression. Deregulation of key cell cycle components is known to contribute to the development of several diseases and is a well- established hallmark of tumorigenesis^1,2. Genome-wide transcriptomic analyses carried out in yeast and mammalian cells have revealed that a large n....

Protocol

1. Cellular Synchronization, Release and Monitoring of Cell Cycle Progression

1. Thymidine- and nocodazole-based (Thy-Noc) synchronization and release of U2OS cells from Mitosis
   1. Prepare required cell culture medium. U2OS cells are routinely grown in DMEM-Glutamine medium complemented with 10% (vol/vol) FBS (optional: 1% penicillin/streptomycin). Perform all the medium preparation and manipulation under sterile conditions and warm up complemented medium (from now on referred to as "complete medium") to 37 °C prior to use.
   2. Seed 2 x 10⁶ U2OS cells per 100 mm dish in 10 mL complete culture medium. In....

Results

Schematic representation of Thy-Noc and HU-based protocols for cell synchronization.

Figure 1 summarizes the steps required for U2OS cell synchronization and subsequent sample collection in order to verify progression through the cell cycle and to perform gene expression analyses.

Phospho-H3 and PI staining are good evaluation parameters to select synchroniz.......

Discussion

Analysis of fine-tune regulated genes involved in transient and specific roles in the cell cycle requires a uniform cell population. Many researchers routinely use long-established tumor cell lines for these purposes, and a variety of methods have been developed to obtain synchronous (or partially synchronous) cell populations, with the aim to accumulate as many cells as possible in defined cell cycle phases. Moreover, strong efforts have been undertaken to improve and optimize well-established synchronization approaches.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
DMEM, high glucose, GutaMAX supplement	Thermo Fisher Scientific	61965-059
FBS, qualified, E.U.-approved, South America origin	Thermo Fisher Scientific	10270-106
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific	15140-122
0.25% Trypsin-EDTA (1x), phenol red	Thermo Fisher Scientific	25200-072
Thymidine	SIGMA	T1895-5G	Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole	SIGMA	M-1404	Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea	SIGMA	H8627	Freshly prepared
Mitomycin C from Streptomyces caespitosus	SIGMA	M4287	1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide	SIGMA	D2650
Propidium iodide	SIGMA	P4170	Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6			Home made
Ethanol	PANREAC	A3678,2500
Chloroform	SIGMA	C2432
Sodium Citrate	PANREAC	131655
Triton X-100	SIGMA	T8787
RNAse A	Thermo Fisher Scientific	EN0531
TRIzol Reagent	LifeTechnologies	15596018
RNeasy Mini kit	QIAGEN	74106
High-Capacity cDNA Reverse Transcription Kit	Thermo Fisher Scientific	4368814
Anti-Cyclin E1 antibody	Cell Signaling	4129	1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody	Cell Signaling	4135	1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin	SIGMA	A-5441	1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty	Millipore	06-570	Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody	Invitrogen	R37116	Specified in the protocol
Secondary anti-mouse-HRP antibody	Santa Cruz Biotechnology	sc-3697	1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG	Biolegio		Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix	Thermo Fisher Scientific	4368702
FACS Tubes	Sarstedt	551578
MicroAmp Optical 96-Well Reaction Plate	Thermo Fisher Scientific	N8010560
Corning 100 mm TC-Treated Culture Dish	Corning
Corning Costar cell culture plates 6 well	Corning	3506
Refrigerated Bench-Top Microcentrifuge	Eppendorf	5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12	Jouan	743205604
NanoDrop Lite Spectrophotometer	Thermo Scientific	ND-LITE-PR
BD FACSCalibur Flow Cytometer	BD Bioscience
QuantStudio 3 Real-Time PCR System	Thermo Fisher Scientific	A28567