A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen

13.5K views

DOI:

10.3791/56585

June 3rd, 2018

In This Article

Summary

A protocol for the development of an electrochemical DNA biosensor comprising a polylactic acid-stabilized, gold nanoparticles-modified, screen-printed carbon electrode to detect Vibrio parahaemolyticus is presented.

Abstract

Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm2). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.

Introduction

A major topic of public and scientific debate in recent years, food poisoning is mainly associated with 3 agents: microorganisms1, chemicals2, and parasites3. Contaminated food can cause serious health consequences in humans, especially in the higher risk group of those with weak immune systems, the elderly, pregnant women, babies, and young children4. With more than a million cases of acute diarrhea occurring annually in children under 5 years old in Africa, Asia, and Latin America, food poisoning is a major global disease5,6 and the World Health Organization has established microorganisms as the most important contributor7. Vibrio parahaemolyticus stands out amongst the most widely recognized virulent strains. Usually found in coastal, estuarine, and marine environments8, it is a Gram-negative bacterium, which becomes active in high salt environments, and causes serious human gastroenteritis when eaten in inadequately cooked, mishandled or raw marine products9. Additionally, existing medical conditions in some people make them prone to wound infection, septicemia or ear infection arising from V. parahaemolyticus10. The virulence factors of V. parahaemolyticus hemolysins are divided into two types which contribute to the disease pathogenesis: thermostable direct hemolysin (TDH) coded by tdh genes, and TDH-related hemolysin coded by trh genes11. The virulence markers (tdh and trh genes) of V. parahaemolyticus are mostly found in clinical specimens rather than in environmental specimens.

V. parahaemolyticus possesses the ability to survive under a broad range of conditions, rapidly responding to environmental changes12. Its proliferation mechanism escalates its hazard potential as its toxicity increases in parallel with cell mass13. Even worse, climate change is providing these bacteria with ample conditions to accelerate their cell population growth14. Due to its high frequency, V. parahaemolyticus needs to be monitored along the food supply chain, particularly in the trade and production of seafood since those products are where they are found in enormous quantities15,16 throughout the world. Currently the bacteria are identified and isolated using a range of methods including biochemical tests, enrichment and selective media17, enzyme-linked immunomagnetic sorbent assay (ELISA)18, pulse-field gel electrophoresis (PFGE)19, latex agglutination tests, and polymerase chain reaction (PCR) tests20. These methods usually require qualified personnel, sophisticated instruments, and laborious techniques which do not provide information about contamination immediately. This severely limits the likelihood of promptly detecting harmful contamination and on-site applications. Rapid detection tools remain an outstanding challenge.

Biosensing is emerging as a promising option for the detection of foodborne pathogens because it offers a time-saving, cost-effective, practical, and real-time analysis method21,22,23,24. However, although there have been many positive results of analyte detection in spiked samples and standard solution using biosensors, there is still a lack of research applied to real samples either in aqueous mixtures or organic extracts25. Recently, electrochemical biosensors using direct and/or indirect deoxyribonucleic acid (DNA) detection have received increased attention among scientists, due to their specific detection of the complementary target via a hybridization event26,27,28,29. These unique approaches are more stable in comparison with enzyme-based biosensors, thus offering a promising technology for miniaturization and commercialization. The target of the study reported here is to construct a fast tool that can detect V. parahaemolyticus with high selectivity, sensitivity, and practicality, based on the DNA sequence specificity during hybridization. Identification strategies involve the combination of polylactic acid-stabilized gold nanoparticles (PLA-AuNPs)30 and screen-printed carbon electrodes (SPCEs) in the presence of the hybridization indicator, methylene blue (MB). The potential of the developed detection construct is further explored using bacteria DNA lysate and fresh cockle samples.

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: All the chemical and biochemical reagents to be used should be of analytical grade and used without further purification. Prepare all solutions using sterile deionized water. Autoclave all glassware prior to sterilization.

Caution: Please use all appropriate safety practices when performing laboratory activities including the use of engineering controls (fume hood, glovebox) and personal protective equipment (safety glasses, gloves, lab coat, full length pants, closed-toe shoes).

1. Fabrication and Characterization of Modified Electrode using PLA-AuNPs

  1. Preparation and characterization of PLA-AuNPs
    1. Quickly add 10 mL of sodium citrate solution (38.8 mM) to 100 mL of boiling aqueous chloroauric acid solution (1 mM) and cool it down to ambient temperature. Observe the changes in color in the prepared AuNPs solution which starts as yellow, changes to blackish and finally ends as dark ruby red.
    2. Place the PLA pellets in a stainless-steel mold for the melting process and preheat them at a temperature of 190 °C for 10 min. Follow with the pressing procedure: put them under a pressure of 2.2 MPa for 1 min as part of the PLA sheet preparation. The PLA sheet will be ready for use after cooling for about 3 h.
    3. Stirring vigorously, dissolve 0.68 mg of the PLA sheets in 5 mL of chloroform at room temperature. Mix the dissolved PLA with 10 mL of the previously prepared AuNPs solution and homogeneously stir it at room temperature. The homogeneous mixtures can then be denoted as PLA-AuNPs and characterized using UV-Vis, XRD, TEM, and FESEM with EDX.
  2. Preparation and characterization of modified screen-printed carbon electrode
    NOTE: The SPCE used in this study comprises a three-electrode system: a counter electrode, a carbon working electrode, and an Ag/AgCl reference electrode.
    1. Quickly pipette 25 µL of the homogenous solution of PLA-AuNPs onto the SPCE and then air dry it for 24 h prior to use.
    2. Electrochemically characterize the modified electrodes, SPCE/PLA-AuNPs, in potassium ferro cyanide (K3[Fe(CN)6]3-/4-) to measure active surface area, electrochemical impedance spectroscopy, repeatability, reproducibility, and stability30.

2. Development of the Electrochemical DNA Biosensor

  1. Probe preparation
    Note: The sequences of the ssDNA probe and complementary DNA were chosen based on information from the National Center for Biotechnology Information (NCBI) database.
    1. Purchase synthetic oligonucleotides (20-mer ssDNA probe, 20-mer complementary DNA, 20-mer mismatched DNA, and 21-mer non-complementary DNA) as lyophilized powder from commercial laboratories, based on the following sequences:
      thiolated ssDNA probe: 5′- / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3′
      complementary DNA: 5′ - CAGTGCTTCTGCATAATCCG - 3′
      one-base mismatched DNA: 5′ - CAGTGCTTCTGC ṪTAATCCG - 3′
      three-base mismatched DNA: 5′ - CAGTGCTTCT Ċ ṪṪTAATCCG - 3′
      non-complementary DNA: 5′ - CGCACAAGGCTCGACGGCTGA - 3′
    2. Prepare stock solutions of all oligonucleotides (100 µM) using a sterile TE solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5), divided into analytical portions. Keep this at -4 °C and then make the appropriate dilutions just prior to use.
  2. Optimization of Immobilization and Hybridization
    Note: An SPCE modified with PLA-AuNPs, denoted as SPCE/PLA-AuNPs, was used for this study and a drop casting method was used for the DNA immobilization and hybridization.
    1. First, immobilize 25 µL of thiolated ssDNA probe on the SPCE/PLA-AuNPs and then air dry it for 24 h at room temperature, after which it will be finally denoted as SPCE/PLA-AuNPs/ssDNA. Determine optimization of the immobilization condition by using three factors: the concentration of ssDNA (ranging from 0.2 to 1.4 µM), time (ranging from 30 to 210 min), and temperature (ranging from 25 to 75 °C).
    2. Pipette 25 µL of the complementary DNA on to the surface of SPCE/PLA-AuNPs/ssDNA to carry out the hybridization event after which it can be finally denoted as SPCE/PLA-AuNPs/dsDNA. Determine optimization of the hybridization condition via the two factors of time (ranging from 5 to 30 min) and temperature (ranging from 25 to 75 °C).
    3. Immerse the immobilized and hybridized electrodes in 20 µM MB for 30 min. Remove the non-specifically adsorbed DNA and excess MB by washing with 0.5 M ABS/20 mM NaCl (pH 4.5) and then rinsing with deionized water. Measure the peak current of MB reduction using DPV technique. Execute the DPV measurement using 0.1 M PBS (pH 7) containing no indicator.
  3. Characterization of the fabricated DNA biosensor
    1. Immerse the SPCE/PLA-AuNPs in 20 µM MB for 30 min, wash with 0.5 M ABS/20 mM NaCl (pH 4.5), and then rinse with deionized water prior to measuring. Follow a similar procedure for all interactions including the probe DNA, complementary DNA, mismatched DNA, and non-complementary DNA samples.
    2. Measure the electrochemical reduction.
      NOTE: We measured DPV using a commercially manufactured Autolab with interface software.
      The DPV measurements of the MB electrochemical reduction performed at a potential ranging from -0.5 V to 0.25 V, with a step potential of 0.005 V, modulation amplitude of 0.05 V, and a scan rate of 7.73 mVs-1 in 0.1 M PBS (pH 7), containing no indicator. The selectivity, sensitivity, reproducibility, and heat stability of the fabricated DNA biosensor were further studied. Reported results were presented as mean value measurements in three replicates.

3. Validation of the Fabricated DNA Biosensor Using Real Samples

  1. Preparation of bacterial strains
    1. Select bacterial samples based on their significant contamination of seafood31,32 .
      NOTE: V. parahaemolyticus as reference strains and 8 other bacterial strains (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, Salmonella enteritis, Klebsiella pneumonia, Escherichia coli O157:H7, Bacillus cereus, and Vibrio alginolyticus) of the common foodborne pathogen were employed for the electrochemical DNA biosensor validation in this study.
    2. Conduct a routine sub-culture of bacterial strains on their respective agar every two weeks to maintain their viability, refer Table 1 for culture conditions.
    3. Maintain long-term preservation of the bacterial strains in their respective growing broths containing 20% (v/v) glycerol at -80 °C as glycerol protects bacteria by preventing the formation of ice crystals that can damage them during the freezing process. Next, inoculate a loop of preserved bacterial cell culture in glycerol stocks into the respective broths. Incubate the broths according to their respective growth time and temperature when needing to revive the bacteria.
    4. Determine the quantity of V. parahaemolyticus cells using a spread plate technique33, a standard and a well-known method for enumerating microorganisms derived from a series of dilutions.
      1. Culture V. parahaemolyticus in Trypticase Soy Broth (TSB + 3% NaCl) at 37 °C in a 140-rpm shaking condition. Then, transfer 1 mL of the bacteria cell culture into 9 mL of TSB + 3% NaCl to obtain a 10-1 dilution factor.
    5. Repeat this step nine times to get a full series of up to 10-10 dilution factor. Next, spread 0.1 mL of each dilution factor (starting from 10-1 to 10-10) on a Vibrio's selective agar plate for colony counting, respectively. Incubate the plates incubated at 37 °C for 24 h.
    6. Use a colony counter to count individual colonies and then back-calculate (count the CFU/pipetted amount x dilution factor) to get a colony-forming unit per milliliter density (CFU mL-1). Derive the concentration of the colony forming units (CFUs) in the bacteria cell suspensions from the calibration plot of CFU mL-1 against absorbance.
  2. Preparation of the PCR assay
    1. Extract genomic DNA following a modified boiled lysis procedure34. First, streak an individual bacterial strain on agar media and inoculate it in broth media, followed by incubating it at its relative growth condition, a 140 rpm shaking condition.
    2. Pipette a 1 mL culture of broth into a micro centrifuge tube. Centrifuge this at 4830 x g and 4 °C for 1 min to obtain pellets. Use about 500 µL of sterile TE buffer for re-suspension with the pellet. Hold the resulting suspension for 10 min at 98 ± 2 °C in a heating block and immediately chill it at -18 °C for 10 min to lyse the cells and release the DNA.
    3. Centrifuge the genomic DNA at 4830 x g and 4 °C for 3 min to obtain a clear suspension and keep the supernatant at -20 °C for further use. Use a biophotometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light) to determine the concentration and purity of the extracted genomic DNA and then identify all strains using standard biochemical assays35 and verifying them by 16S rRNA gene sequencing36. Finally, denature the genomic DNA at 92 °C for 2 min and cool it rapidly in ice water prior to application to the biosensor.
    4. Further confirm the presence V. parahaemolyticus using PCR to target the toxR gene. Perform this procedure in a thermocycler using a primer pair (5'-GTCTTCTGACGCAATCGTTG-3' and 5'-ATACGAGTGGTTGCTGTCATG-3'). Optimize the PCR amplification in a total reaction volume of 25 µL consisting of sterile water (15.5 µL), buffer (5 µL), primer (1 µL, 10 µM), dNTP mix (1 µL), DNA template (2 µL), and Taq DNA polymerase (0.2 µL, 10x).
    5. Mix the components well and arrange the PCR amplification of the target sequence in a thermocycler programmed for 30 cycles of amplification. In our study, each cycle consisted of three-step reactions i.e., initial denaturation (94 °C, 3 min) followed by 30 cycles of denaturation (94 °C, 1 min), annealing (63 °C, 1.5 min) and extension (72 °C, 1.5 min), followed by final extension (72 °C, 7 min).
    6. Determine the amplified products and their sizes via electrophoresis on 1.5% agarose gel. Capture the gel images with a commercially produced gel-documentation system.
  3. Preparation of cockle samples
    1. Obtain fresh samples.
      NOTE: Our fresh cockles (Anadara granosa) were obtained from the wet market in Serdang, Selangor, and quickly brought to the laboratory in an ice cooler box for analysis. Divide the samples into 2 groups, namely the treated and untreated group, assuming that the cockles were harvested uniformly from the start of the harvest until placing them into cold storage.
    2. Pre-treat cockles in the treated group by storing them at -20 °C for 24 h, followed by exposure to UV light at 20 °C for 4 h prior to DNA extraction.
      NOTE: The freezing temperature and UV exposure used for the controlled group kills or at least limits the naturally accumulating V. parahaemolyticus in the cockles. Do not apply a higher pasteurization regime of 70 °C as the aim of the controlled condition in this study is to mimic the actual situation of the fresh cockles. Meanwhile, analyze samples directly from the untreated group without any pre-treatment as soon as they arrive in the laboratory.
    3. Subculture a strain of V. parahaemolyticus ATCC 17802 in TSB (3% NaCl). Determine the level of viable cells in the inoculum via plating of appropriate dilutions of TSB (3% NaCl) on CA in order to obtain an inoculum of 104 CFU mL-1 of V. parahaemolyticus. Wash each cockle in distilled water and scrub it free of dirt before using sterile forceps in a laminar flow cabinet to remove the tissues from the shell.
    4. Homogenize about 10 g of cockle tissue samples with a homogenizer in 90 mL of sterile TSB (3% NaCl) for 60 s. Add a known amount of V. parahaemolyticus to 9 mL of the homogenized sample broth for the spiked samples. Use the unspiked samples as a negative control. Estimate the cell counts of V. parahaemolyticus spiked on to the cockle samples by plating 0.1 mL of the samples on CA, and subsequently, pipetting 1 mL of samples into a microcentrifuge tube for DNA sample extraction, to be used in the biosensor and PCR assay.
    5. Extract the genomic DNA of the V. parahaemolyticus from the spiked and unspiked samples following a modified boiled lysis procedure36. Finally, determine the DNA concentration and purity using a bio photometer measurement with UV absorption at a wavelength of 260 nm (as nucleic acids absorbing wavelength of light) and also at a wavelength of 280 nm (as the proteins absorbing wavelength of light).

Access restricted. Please log in or start a trial to view this content.

Results

Formation of AuNPs was revealed through the change in color of the aqueous solution with sodium citrate present. This caused the color to change from light yellow to a deep ruby red. The generation of PLA-AuNPs was confirmed from the UV-vis spectra (Figure 1) where the growth of the surface plasmon resonance (SPR) peak was found at around 540 nm. The formation and existence of PLA-AuNPs was indicated at 500-600 nm wavelength ranges, depending on particle size...

Access restricted. Please log in or start a trial to view this content.

Discussion

The critical steps in a framework for successful development of this type of electrochemical biosensor are selection of appropriate biological recognition elements for the transducer (nucleic acid or DNA here); chemical approach for constructing the sensing layer of the transducer; transduction material; optimization of DNA immobilization and hybridization; and validation of the developed biosensor using real samples.

Core to the successful development of a sensitive and selective electrochemi...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors would like to acknowledge the support of Universiti Putra Malaysia.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Acetic acidMerck100056
ChloroformMerck102445
Diaminoethane tetraacetic acidPromegaE5134
Dibasic sodium phosphate Sigma-AldrichS9763
Disodium hydrogen phosphateSigma-Aldrich255793
Ethanol Sigma-Aldrich16368
Gold (III) chloride trihydrateSigma-Aldrich520918
Hydrochloric acidMerck100317
Methylene blueSigma-AldrichM44907
Monobasic sodium phosphate, monohydrateSigma-AldrichS3522
Phosphate-buffered salineSigma-AldrichP5119
Poly(lactic acid) resin, commercial grade 4042DNatureWorks4042D
Potassium chlorideR&M Chemicals59435
Potassium dihydrogen phosphateSigma-AldrichP9791
Potassium hexacyanoferrate IIIR&M Chemicals208019
Sodium acetate anhydrous saltSigma-AldrichS2889
Sodium chlorideSigma-AldrichS9888
Trisodium citrateSigma-AldrichS1804
Tris(hydroxymethyl) aminomethaneFisher ScientificT395-100
Tris-BaseFisher ScientificBP152-500
2X PCR Master Mix with Dual-DyeNorgen Biotek28240
Agarose gelMerck101236
Bolton AgarMerck100079
Bolton BrothMerck100079
CHROMagar VibrioCHROMagarVB910
dNTPsPromegaU1511
Nuclease-free waterThermo ScientificR0581
Eosin methylene blue agar Merck101347
GelRedBiotium41001
GlycerolMerck104092
Go Taq BufferPromegaM7911
Loading dye 100 bp DNA ladderPromegaG2101
Loading dye 1kb DNA ladderPromegaG5711
Magnesium chloridePromega91176
Mannitol egg yolk polymyxin agarMerck105267
McConkey AgarMerck105465
Nutrient BrothMerck105443
Taq polymeraseMerck71003
Trypticase Soy BrothMerck105459
Trypticase Soy AgarMerck105458

References

  1. Gould, L. H., Rosenblum, I., Nicholas, D., Phan, Q., Jones, T. F. Contributing factors in restaurant-associated foodborne disease outbreaks, FoodNet sites, 2006 and 2007. Journal of Food Protection. 76, 1824-1828 (2013).
  2. Arvanitoyannis, I. S., Kotsanopoulos, K. V., Papadopoulou, A. Rapid detection of chemical hazards (toxins, dioxins, and PCBs) in seafood. Critical Reviews in Food Science and Nutrition. 54, 1473-1528 (2014).
  3. Robertson, L. J., Sprong, H., Ortega, Y. R., van der Giessen, J. W. B., Fayer, R. Impacts of globalisation on foodborne parasites. Trends in Parasitology. 30, 37-52 (2014).
  4. Sandilands, E. A., Bateman, D. N. The epidemiology of poisoning. Medicine. 44, 76-79 (2016).
  5. Boschi-Pinto, C., Velebit, L., Shibuya, K. Estimating child mortality due to diarrhoea in developing countries. Bulletin of the World Health Organization. 86, 710-717 (2008).
  6. Farthing, M. J. G. Diarrhoea: A Significant Worldwide Problem. International Journal of Antimicrobial Agents. 14, 65-69 (2000).
  7. World Health Organization. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015. , 1-255 (2015).
  8. Yeung, M., Boor, K. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease. 1, 74-88 (2004).
  9. Sakazaki, R. Foodborne Diseases. Cliver, D. O., Riemann, H. P. , Academic Press. 127-136 (2002).
  10. Grochowsky, J., Odom, S. R., Akuthota, P., Stead, W. Primary Septicemia and Abdominal Compartment Syndrome From Vibrio parahaemolyticus Infection in a 40-Year-Old Patient With No Known Immunocompromise. Infectious Disease in Clinical Practice. 22, (2013).
  11. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Frontiers in Microbiology. 5, 805(2014).
  12. Kalburge, S. S., Whitaker, W. B., Boyd, E. F. High-Salt Preadaptation of Vibrio parahaemolyticus Enhances Survival in Response to Lethal Environmental Stresses. Journal of Food Protection. 77, 246-253 (2014).
  13. Esteves, K., Hervio-Heath, D., Mosser, T., Rodier, C., Tournoud, M. G., Jumas-Bilak, E., Colwell, R. R., Monfort, P. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean Coastal lagoons. Applied and Environmental Microbiology. 81, 7600-7609 (2015).
  14. Khandeparker, L., Anil, A. C., Naik, S. D., Gaonkar, C. C. Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment. Marine Pollution Bulletin. 96, 337-343 (2015).
  15. Caburlotto, G., Suffredini, E., Toson, M., Fasolato, L., Antonetti, P., Zambon, M., Manfrin, A. Occurrence and molecular characterization of Vibrio parahaemolyticus in crustaceans commercialised in Venice area, Italy. International Journal of Food Microbiology. 220, 39-49 (2016).
  16. Wong, H. C., Chen, M. C., Liu, S. H., Liu, D. P. Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. International Journal of Food Microbiology. 52, 181-188 (1999).
  17. Rosec, J. P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. The international standard ISO/TS 21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food Microbiology. 157, 189-194 (2012).
  18. Maniyankode, R. A., Kingston, J. J., Murali, H. S., Batra, H. V. Specific identification of vibrio parahaemolyticus employing monoclonal antibody based immunoassay. International Journal of Pharmacy and Biological Sciences. 4 (2), B156-B164 (2013).
  19. Suffredini, E., Lopez-Joven, C., Maddalena, L., Croci, L., Roque, A. Pulsed-field gel electrophoresis and PCR characterization of environmental Vibrio parahaemolyticus strains of different origins. Applied and Environmental Microbiology. 77, 6301-6304 (2011).
  20. Bhattacharyya, N., Hou, A. A pentaplex PCR assay for detection and characterization of Vibrio vulnificus and Vibrio parahaemolyticus isolates. Letters in Applied Microbiology. 57, 233-240 (2013).
  21. da Silva, E. T. S. G., et al. Electrochemical Biosensors in Point-of-Care Devices: Recent Advances and Future Trends. ChemElectroChem. 4 (4), 778-794 (2017).
  22. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. Sensitive detection of multiple pathogens using a single DNA probe. Biosensors and Bioelectronics. 86, 398-405 (2016).
  23. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. A simple, portable, electrochemical biosensor to screen shellfish for Vibrio parahaemolyticus. AMB Express. 7 (1), 41(2017).
  24. Zhang, J., Li, Z., Zhang, H., Wang, J., Liu, Y., Chen, G. Rapid detection of several foodborne pathogens by F0F1-ATPase molecular motor biosensor. Journal of Microbiological Methods. 93, 37-41 (2013).
  25. Barsan, M. M., Ghica, E. M., Brett, C. M. A. Portable biosensing of food toxicants and environmental pollutants. Nikolelis, D. P., Varzakas , T., Erdem, A., Nikoleli, G. P. , CRC Press, Taylor & Francis Group. Boca Raton. 33-69 (2014).
  26. Kwun, J., Yun, S., Park, L., Lee, J. H. Development of 1,1'-oxalyldiimidazole chemiluminescent biosensor using the combination of graphene oxide and hairpin aptamer and its application. Talanta. 119, 262-267 (2014).
  27. Thavanathan, J., Huang, N. M., Thong, K. L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. International Journal of Nanomedicine. 10, 2711-2722 (2015).
  28. Hushiarian, R., Yusof, N. A., Abdullah, A. H., Ahmad, S. A. A., Dutse, S. W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Analytical Chemistry Research. 6, 17-25 (2015).
  29. Dutse, S. W., Yusof, N. A., Ahmad, H., Hussein, M. Z., Zainal, Z., Hushiarian, R., Hajian, R. An Electrochemical Biosensor for the Determination of Ganoderma boninense Pathogen Based on a Novel Modified Gold Nanocomposite Film Electrode. Analytical Letters. 47 (5), 819-832 (2014).
  30. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hajian, R. Characterization of Polylactide-Stabilized Gold Nanoparticles and Its Application in the Fabrication of Electrochemical DNA Biosensors. Journal of the Brazilian Chemical Society. 27 (9), 1679-1686 (2016).
  31. Vongkamjan, K., Wang, S., Moreno Switt, A. I. Rapid detection of foodborne bacterial pathogens in seafood. Handbook of Seafood: Quality and Safety Maintenance and Applications. , 247-257 (2016).
  32. Wang, F., Jiang, L., Yang, Q., Han, F., Chen, S., Pu, S., Vance, A., Ge, B. Prevalence and antimicrobial susceptibility of major foodborne pathogens in imported seafood. Journal of Food Protection. 74 (9), 1451-1461 (2011).
  33. Szermer-Olearnik, B., Sochocka, M., Zwolinska, K., Ciekot, J., Czarny, A., Szydzik, J., Kowalski, K., Boratynski, J. Comparison of microbiological and physicochemical methods for enumeration of microorganisms. Postepy Higieny i Medycyny Doswiadczalnej. 68, 1392-1396 (2014).
  34. Ivanov, I. G., Bachvarov, D. R. Determination of plasmid copy number by the "boiling" method. Analytical Biochemistry. 165 (1), 137-141 (1987).
  35. Gopireddy, V. R. Biochemical tests for the identification of bacteria. International Journal of Pharmacy and Technology. 3 (4), 1536-1555 (2011).
  36. Böhme, K., Fernández-No, I. C., Pazos, M., Gallardo, J. M., Barros-Velázquez, J., Cañas, B., Calo-Mata, P. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting. Electrophoresis. 34 (6), 877-887 (2013).
  37. Seoudi, R., Fouda, A. A., Elmenshawy, D. A. Synthesis, characterization and vibrational spectroscopic studies of different particle size of gold nanoparticle capped with polyvinylpyrrolidone. Physica B: Condensed Matter. 405, 906-911 (2010).
  38. Mishra, A., Harper, S., Yun, S. I. Interaction of biosynthesized gold nanoparticles with genomic DNA isolated from E. coli and S. aureus. Nanotechnology (IEEE-NANO). , 1745-1750 (2011).
  39. Sugimoto, T. Formation of modoispersed nano- and micro-particles controlled in size, shape, and internal structure. Chemical Engineering and Technology. 26, 313-321 (2003).
  40. Rath, C., Sahu, K. K., Kulkarni, S. D., Anand, S., Date, S. K., Das, R. P., Mishra, N. C. Microstructure-dependent coercivity in monodispersed hematite particles. Applied Physics Letters. 75, 4171-4173 (1999).
  41. Abbas, M., Wu, Z. Y., Zhong, J., Ibrahim, K., Fiori, A., Orlanducci, S., Sessa, V., Terranova, M. L., Davoli, I. X-ray absorption and photoelectron spectroscopy studies on graphite and single-walled carbon nanotubes: Oxygen effect. Applied Physics Letters. 87 (5), 051923(2005).
  42. Lim, S. C., Choi, Y. C., Jeong, H. J., Shin, Y. M., An, K. H., Bae, D. J., Lee, Y. H., Lee, N. S., Kim, J. M. Effect of gas exposure on field emission properties of carbon nanotubes arrays. Advanced Materials. 13, 1563-1567 (2001).
  43. Kim, B. H., Kim, B. R., Seo, Y. G. A study on adsorption equilibrium for oxygen and nitrogen into carbon nanotubes. Adsorption. 11, 207-212 (2005).
  44. Bard, A. J., Faulkner, L. R. Electrochemical methods: Fundamentals and applications. , John Wiley & Sons Inc. (2000).
  45. Tan, Q., Wang, L., Ma, L., Yu, H., Ding, J., Liu, Q., Xiao, A., Ren, G. Study on anion electrochemical recognition based on a novel ferrocenyl compound with multiple binding sites. Journal of Physical Chemistry B. 112, 11171-11176 (2008).
  46. Manivannan, S., Ramaraj, R. Polymer-embedded gold and gold/silver nanoparticle-modified electrodes and their applications in catalysis and sensors. Pure and Applied Chemistry. 83, 2041-2053 (2011).
  47. Benali, O., Larabi, L., Traisnel, M., Gengembre, L., Hareka, Y. Electrochemical, theoretical and XPS studies of 2-mercapto-1-methylimidazole adsorption on carbon steel in 1 M HClO4. Applied Surface Science. 253, 6130-6139 (2007).
  48. Shi, Y., Wen, L., Li, F., Cheng, H. M. Nanosized Li4Ti5O12/graphene hybrid materials with low polarization for high rate lithium ion batteries. Journal of Power Sources. 196, 8610-8617 (2011).
  49. Bentiss, F., Traisnel, M., Lagrenee, M. The substituted 1,3,4-oxadiazoles: a new class of corrosion inhibitors of mild steel in acidic media. Corrosion Science. 42, 127-146 (2000).
  50. Wang, M., Gong, W., Meng, Q., Zhang, Y. Electrochemical DNA impedance biosensor for the detection of DNA hybridization with polymeric film, single walled carbon nanotubes modified glassy carbon electrode. Russian Journal of Electrochemistry. 47, 1368-1373 (2011).
  51. Herdt, A. R., Drawz, S. M., Kang, Y., Taton, T. A. DNA dissociation and degradation at gold nanoparticle surfaces. Colloids and Surfaces B: Biointerfaces. 51 (2), 130-139 (2006).
  52. Bhatt, N., Huang, P. J. J., Dave, N., Liu, J. Dissociation and degradation of thiol-modified DNA on gold nanoparticles in aqueous and organic solvents. Langmuir. 27, 6132-6137 (2011).
  53. Liu, X., Jang, C. H., Zheng, F., Jürgensen, A., Denlinger, J. D., Dickson, K. A., Raines, R. T., Abbott, N. L., Himpsel, F. J. Characterization of protein immobilisation at silver surfaces by near edge X-ray absorption fine structure spectroscopy. Langmuir. 22, 7719-7725 (2006).
  54. Willey, T. M., Andrew, L., Vance, T., Buuren, V., Bostedt, C., Terminello, L. J., Fadley, C. S. Rapid degradation of alkanethiol-based self-assembled monolayers on gold in ambient laboratory conditions. Surface Science. 576 (1), 188-196 (2005).
  55. Farjami, E., Clima, L., Gothelf, K., Ferapontova, E. E. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. Analyst. 135, 1443-1448 (2010).
  56. Lin, X., Ni, Y., Kokot, S. An electrochemical DNA-sensor developed with the use of methylene blue as a redox indicator for the detection of DNA damage induced by endocrine-disrupting compounds. Analytica Chimica Acta. 867, 29-37 (2015).
  57. Zhang, F. T., Nie, J., Zhang, D. W., Chen, J. T., Zhou, Y. L., Zhang, X. X. Methylene Blue as a G-Quadruplex Binding Probe for Label-Free Homogeneous Electrochemical Biosensing. Analytical Chemistry. 86, 9489-9495 (2014).
  58. Ning, L., Li, X., Yang, D., Miao, P., Ye, Z., Li, G. Measurement of Intracellular pH Changes Based on DNA-Templated Capsid Protein Nanotubes. Analytical Chemistry. 86, 8042-8047 (2014).
  59. Sani, N. D. M., Heng, L. Y., Surif, S., Lazim, A. M., et al. AIP Conference Proceedings. Murad, A., et al. 1571, 636-640 (2013).
  60. Xu, P., Wang, J., Xu, Y., Chu, H., Shen, H., Zhang, D., Zhao, M., Liu, J., Li, G. Binding modes and interaction mechanism between different base pairs and methylene blue trihydrate: a quantum mechanics study. Advances in Experimental Medicine and Biology. 827, 187-203 (2015).
  61. Guo, Y., Chen, J., Chen, G. A label-free electrochemical biosensor for detection of HIV related gene based on interaction between DNA and protein. Sensors & Actuators, B: Chemical. 184, 113-117 (2013).
  62. Huang, K. J., Liu, Y. J., Wang, H. B., Wang, Y. Y., Liu, Y. M. Sub-femtomolar DNA detection based on layered molybdenum disulfide/multi-walled carbon nanotube composites, au nanoparticle and enzyme multiple signal amplification. Biosensors and Bioelectronics. 55, 195-202 (2014).
  63. Kong, R. M., Song, Z. L., Meng, H. M., Zhang, X. B., Shen, G. L., Yu, R. Q. A label-free electrochemical biosensor for highly sensitive and selective detection of DNA via a dual-amplified strategy. Biosensors and Bioelectronics. 54, 442-447 (2014).
  64. Rashid, J. I. A., Yusof, N. A., Abdullah, J., Hashim, U., Hajian, R. Novel Disposable Biosensor Based on SiNWs/AuNPs Modified-Screen Printed Electrode for Dengue Virus DNA Oligomer Detection. IEEE Sensors Journal. 15, 4420-4421 (2015).
  65. Yingkajorn, M., Sermwitayawong, N., Palittapongarnpimp, P., Nishibuchi, M., Robins, W. P., Mekalanos, J. J., Vuddhakul, V. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand. Microbial Ecology. 67, 849-856 (2014).
  66. Ahmad Ganaie, H., Ali, M. N. Short term protocol for the isolation and purification of DNA for molecular analysis. International Journal of Pharmaceutical Sciences Review and Research. 24, 266-270 (2014).
  67. Nakano, K., Kimura, T., Kitamura, Y., Ihara, T., Ishimatsu, R., Imato, T. Potentiometric DNA sensing platform using redox-active DNA probe pair for sandwich-type dual hybridization at indicator electrode surface. Journal of Electroanalytical Chemistry. 720-721, 71-75 (2014).
  68. Yang, J., Jim Yang, L., Heng-Phon, T., Gan-Moog, C. Inhibition of DNA hybridization by small metal nanoparticles. Biophysical Chemistry. 120, 87-95 (2006).
  69. Niu, L. M., Liu, F., Wang, W., Lian, K. Q., Ma, L., Shi, H. M., Kang, W. J. Electrochemical Behavior of Paraquat on a Highly Ordered Biosensor Based on an Unmodified DNA-3D Gold Nanoparticle Composite and Its Application. Electrochimica Acta. 153, 190-199 (2015).
  70. Li, Z., Miao, X., Xing, K., Zhu, A., Ling, L. Enhanced electrochemical recognition of double-stranded DNA by using hybridization chain reaction and positively charged gold nanoparticles. Biosensors and Bioelectronics. 74, 687-690 (2015).
  71. Niu, S., Sun, J., Nan, C., Lin, J. Sensitive DNA biosensor improved by 1,10-phenanthroline cobalt complex as indicator based on the electrode modified by gold nanoparticles and graphene. Sensors and Actuators B: Chemical. 176, 58-63 (2013).
  72. Yi, H., Xu, W., Yuan, Y., Bai, L., Wu, Y., Chai, Y., Yuan, R. A pseudo triple-enzyme cascade amplified aptasensor for thrombin detection based on hemin/G-quadruplex as signal label. Biosensors and Bioelectronics. 54, 415-420 (2014).
  73. Das, R., Sharma, M. K., Rao, V. K., Bhattacharya, B. K., Garg, I., Venkatesh, V., Upadhyay, S. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode. Journal of Biotechnology. 188, 9-16 (2014).
  74. Han, X., Fang, X., Shi, A., Wang, J., Zhang, Y. An electrochemical DNA biosensor based on gold nanorods decorated graphene oxide sheets for sensing platform. Analytical Biochemistry. 443 (2), 117-123 (2013).
  75. Huang, K. J., Liu, Y. J., Zhang, J. Z., Cao, J. T., Liu, Y. M. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification. Biosensors and Bioelectronics. 67, 184-191 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Vibrio parahaemolyticus DetectionPolylactic Acid Gold NanoparticlesScreen Printed Carbon ElectrodeDifferential Pulse VoltammetryMethylene Blue Redox IndicatorDNA Hybridization PrincipleFoodborne Pathogen AnalysisActive Surface AreaCharge Transfer Resistance