Long-term empirical data are critical to the understanding of evolutionary dynamics and persistence of natural populations. Such data are generally challenging to obtain because of logistic difficulties associated with accessing temporal samples and the requirement of committing long-term to data collection. In the two key studies presented here, empirical evidence of the response to temperature of a central zooplankter in freshwater ecosystems is provided over evolutionary times. This is enabled by the use of layered dormant egg banks that provide the opportunity to study the response of historical populations and their modern descendants to environmental stress in common experimental settings.
Common garden experiment
The common garden experiment showed that all life history traits responded to temperature (Figure 6 and Figure 7). The ANOVA analysis revealed that all (sub)populations respond to temperature via plasticity (Table 2), except for mortality, which is unresponsive. Evidence of evolutionary changes (differences among (sub)populations) was observed only in population growth rate (Table 2), which significantly increased in two of the three (sub)populations at 24 °C (Figure 6).

Figure 6: Common garden experiment. Reaction norms for life history traits (fecundity, size, and age at maturity) and population growth rate (r) are shown for each (sub)population under temperature warming (24 °C) as compared to the common garden and current temperature regime (18 °C). The population growth rate 'r' is calculated using the Eulerian equation (1). Confidence intervals are shown. (Sub)populations are color coded: (i) blue: 1960-1970; (ii) green: 1970–1985; (iii) red: >1999. Please click here to view a larger version of this figure.

Figure 7: Mortality. Mortality rates per (sub)population (1960-1970; 1970-1985; >1999) are shown under warming (24 °C) as compared to modern temperature regimes (18 °C). Please click here to view a larger version of this figure.
Mesocosm experiment
After four weeks of selection, represented by warming at 24 °C, the frequency of the three (sub)populations did not change significantly (χ2 = 0.55, P = 0.76) as compared to the initial inoculum (Figure 8). Among the 30 genotypes inoculated in the mesocosm experiment, the majority was identified after four weeks of selection (Figure 9). Specifically, 70% of the inoculated genotypes were recovered, compatible with Poissonian expectation of recovering at least one representative of each genotype in a sample of 32 individuals.

Figure 8: Competition experiment - population frequency. Population-averaged median and quartiles (25th and 75th), is shown for the three (sub)populations of D. magna after four weeks of selection in mesocosm competition experiments (24 °C), as compared to an initial equal frequency (at the start). (Sub)populations are color coded as shown in Figure 6. Please click here to view a larger version of this figure.

Figure 9: Competition experiment - genotype frequency. Genotype frequencies — averaged median and quartiles (25th and 75th), are shown after four weeks of exposure to warming (24 °C) as compared to an initial equal frequency of genotypes (dotted line). Names on the x-axis are the inoculated genotypes ID, grouped per (sub)population (blue, 1960-1970; green, 1970-1985; red, >1999). Please click here to view a larger version of this figure.
| Locus | AN | Size range (bp) | Primers (5’-3’) | Dye label | Repeat motif | Tm |
| B008 | HQ234154 | 150–170 | F: TGGGATCACAACGTTACACAA | VIC | (TC)9 | 56 |
| R: GCTGCTCGAGTCCTGAAATC |
| B030 | HQ234160 | 154–172 | F: CCAGCACACAAAGACGAA | PET | (GA)11 | 56 |
| R: ACCATTTCTCTCCCCCAACT |
| B045 | HQ234168 | 118–126 | F: GCTCATCATCCCTCTGCTTC | NED | (TG)8 | 56 |
| R: ATAGTTTCAGCAACGCGTCA |
| B050 | HQ234170 | 234–248 | F: TTTCAAAAATCGCTCCCATC | 6FAM | (GAA)6 | 56 |
| R: TATGGCGTGGAATGTTTCAG |
| B064 | HQ234172 | 135–151 | F: CTCCTTAGCAACCGAATCCA | 6FAM | (TC)8 | 56 |
| R: CAAACGCGTTCGATTAAAGA |
| B074 | HQ234174 | 196–204 | F: TCTTTCAGCGCACAATGAAT | NED | (GT)9 | 56 |
| R: TGTGTTCCTTGTCAACTGTCG |
| B096 | HQ234181 | 234–240 | F: GGATCTGGCAGGAAGTGGTA | VIC | (AC)15 | 56 |
| R: TTGAACCACGTCGAGGATTT |
| B107 | HQ234184 | 250–274 | F: GGGGTGAAGCATCAAAGAAA | PET | (CT)8 | 56 |
| R: TGTGACCAGGATAAGAGAAGAGG |
Table 1: Microsatellite multiplex. The NCBI Accession Number (AN), the multiplex information, the PCR primer sequences, the PCR size range, the repeat motif, the dye used to label the forward primer, and the annealing temperature (Tm) are shown.
| Pop Growth rate (r) | Df | F | P |
| Evolution (Pop) | 2 | 30.309 | <0.001 |
| Plasticity (Temp) | 1 | 531.546 | <0.001 |
| Evol. Plasticity (Pop x Temp) | 2 | 65.137 | <0.001 |
| Mortality | Df | F | P |
| Evolution (Pop) | 2 | 2.234 | 0.1162 |
| Plasticity (Temp) | 1 | 2.679 | 0.1071 |
| Evol. Plasticity (Pop x Temp) | 2 | 1.8657 | 0.164 |
| Fecundity | Df | F | P |
| Evolution (Pop) | 2 | 1.8852 | 0.1633 |
| Plasticity (Temp) | 1 | 6.8934 | 0.0117 |
| Evol. Plasticity (Pop x Temp) | 2 | 1.6511 | 0.203 |
| Size at maturity | Df | F | P |
| Evolution (Pop) | 2 | 0.211 | 0.8106 |
| Plasticity (Temp) | 1 | 11.1361 | 0.0017 |
| Evol. Plasticity (Pop x Temp) | 2 | 0.6586 | 0.5225 |
| Age at maturity | Df | F | P |
| Evolution (Pop) | 2 | 0.7811 | 0.4637 |
| Plasticity (Temp) | 1 | 8.0764 | 0.0066 |
| Evol. Plasticity (Pop x Temp) | 2 | 0.088 | 0.9159 |
Table 2: Analysis of variance(ANOVA). Analysis of variance testing whether changes in life history traits and population growth rate of the resurrected (sub)populations exposed to warming are explained by evolutionary adaptation (populations), plasticity (temperature treatment), and their interaction term (evolution of plasticity). Significant p-values (p<0.05) are shown in bold.
Supplementary Video 1: Sampling of sediment cores. The use of a Big Ben corer is shown. Big Ben is a core tube of approximately 1.5 m in length with an internal tube diameter of 14 cm. It consists of a piston on a rope and a corer head, to which rods are attached to drive the tube into the sediment. A core catcher is used to support the core tube that is deployed from a small vessel. The piston is pushed down into the sediment by gravitational pressure. A framework is used to support the core tube during the extrusion process carried out using a modified bottle jack that pushes the piston upwards. Each sediment layer is collected on a flat metal surface and transferred to transparent sampling bags for long term storage [dark and cold (4 °C) conditions]. Please click here to download this file.
Supplementary Video 2: Sediment sieving. The equipment required for sieving sediment is a precision scale, white sampling trays and geological sieves. From each sediment layer, at least 5 g are retained for radiometric dating. The remainder of the sediment is used to isolate ephippia. The sediment is sieved through two geological sieves, one with 1 mm and a second with 125 µm mesh size, piled on top of each other. Medium is poured on the 1 mm mesh sieve to separate clay, large invertebrates, and particulate matter. Medium poured on the second sieve with 125 µm mesh separates D. magna ephippia and small particulate matter. Aliquots of sediment are then transferred to a white sampling tray. D. magna ephippia are spotted by eye in the white background tray. Ephippia from each layer are collected in separate Petri dishes. Please click here to download this file.
Supplementary Video 3: Decapsulation. Under a stereomicroscope, D. magna ephippia are opened with microdissection forceps by applying pressure on the spine of the chitin case. The inner egg membrane is delicately removed and resting eggs gently transferred with a Pasteur pipette to a Petri dish containing 10 mL of medium. Please click here to download this file.
Supplementary Video 4: Hatching. After exposure to a long photoperiod and 20 °C, embryo development resumes between 48 h and few weeks. When development is complete, the embryos break free from the egg shell and freely swim in the medium. Please click here to download this file.