Method Article

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

DOI:

10.3791/56919

January 2nd, 2018

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of >6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Canonical Notch signaling is a short-range cell to cell communication mechanism that requires physical contact of neighboring cells to facilitate the interaction between Notch receptors and their ligands1. Interaction of Notch receptor (present on the surface of signal-receiving cells) with ligands (present on the surface of signal-sending cells) initiates Notch signaling and is known as trans-activation2. On the other hand, interaction between Notch and its ligands in the same cell leads to the inhibition of Notch pathway and is known as cis-inhibition3. The balance between trans- and cis-interactions is required to ensure optimum ligand-dependent Notch signaling4. Drosophila has one Notch receptor and two ligands (Delta and Serrate) as opposed to mammals, which have four Notch receptors and five ligands [jagged 1 (JAG1), JAG2, delta-like 1 (DLL1), DLL3 and DLL4]5. Having this simplicity, the Drosophila model offers the ease to dissect/study the effects of pathway modifiers on Notch-ligand interactions and subsequently on Notch signaling. In certain contexts during animal development (including wing development in Drosophila), both cis- and trans-interactions are involved to achieve proper Notch signaling and cell fate1,6. It is important to distinguish the effects of Notch pathway modifiers in these contexts on cis- versus trans-interactions of Notch with its ligands.

Our group previously reported that addition of a carbohydrate residue called xylose to Drosophila Notch negatively regulates Notch signaling in certain contexts, including wing development7. Loss of shams (the enzyme that xylosylates Notch) leads to a "loss of wing vein" phenotype7. More recently, gene dosage experiments and clonal analysis were used to show that loss of shams enhances Delta-mediated Notch singling. To distinguish whether the enhanced Notch signaling in shams mutants is a result of decreased cis-inhibition or increased trans-activation, ectopic overexpression studies of Notch ligands in larval wing imaginal discs using the dpp-GAL4 driver were performed. These experiments provided evidence suggesting that Shams regulates trans-activation of Notch by Delta without affecting Notch cis-inhibition by ligands8. However, feed-back regulations and effects of endogenous ligands might complicate the interpretation of ectopic overexpression studies1,6,9.

To resolve this issue, Drosophila S2 cells10 were used, which provide a simple in vitro system for Notch-ligand interaction studies11,12. S2 cells do not express endogenous Notch receptor and Delta ligand11 and express a low level of Serrate13, which does not affect Notch-ligand aggregation experiments8. Therefore, S2 cells can be stably or transiently transfected by Notch and/or individual ligands (Delta or Serrate) to generate cells that exclusively express the Notch receptor or one of its ligands, or a combination of them. Mixing of Notch-expressing S2 cells with ligand-expressing S2 cells results in the formation of heterotypic aggregates mediated by receptor-ligand binding11,12,14. Quantification of the aggregate formation provides a measure of trans-binding between Notch and its ligands15 (Figure 1). Similarly, S2 cells can be co-transfected with Notch and Delta or Serrate ligands (i.e. cis-ligands). Cis-ligands in these Notch-expressing S2 cells abrogate the binding of Notch with trans-ligands and result in decreased aggregate formation8,12,14. The relative decrease in aggregate formation caused by cis-ligands provides a measure of the inhibitory effect of cis-ligands on binding between Notch and trans-ligands (Figure 2). Accordingly, cell aggregation assays were utilized to examine the effect of loss of xylosylation on trans- and cis-interactions between Notch and its ligands.

Here, we present a detailed protocol for cell aggregation assays aimed to evaluate the binding of Notch with trans-ligands and its inhibition by cis-ligands using Drosophila S2 cells. As an example, we provide the data that allowed us to determine the effect of Notch xylosylation on binding between Notch and trans-Delta8. These straightforward assays provide a semi-quantitative assessment of Notch-ligand interactions in vitro and help determine the molecular mechanisms underlying the in vivo effects of Notch pathway modifiers.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of Double Stranded RNA (dsRNA) for Shams Knockdown

  1. PCR amplification of the products
    1. Use wild-type yellow white (y w) genomic DNA and pAc5.1-EGFP as template and the following primer pairs to amplify the DNA fragments used in dsRNA synthesis. Use the following PCR thermal profile: Denaturation (95 °C, 30 s), Annealing (58 °C, 30 s) and Extension (72 °C, 1 min).
      Enhanced Green Fluorescent Protein (EGFP) dsRNA primers (5'-3')-
      Forward primer- GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG
      Reverse primer- GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG
      Shams dsRNA primers (5'-3')-
      Forward primer- TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT
      Reverse primer- TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA
      NOTE: EGFP dsRNA is used as negative control.
  2. Gel-purify the polymerase chain reaction (PCR) products using a commercial gel purification kit according to manufacturer's protocol.
  3. Perform in vitro transcription using a commercial product capable of transcribing from a T7 promoter according to manufacturer's protocol.
  4. Purify the dsRNA using an RNA purification kit according to manufacturer's protocol and store at -80 °C.
  5. Assess the efficiency of shams knockdown by using the following steps (1.5.1-1.5.5).
    1. Count the cells manually using a hemocytometer and plate 5 x 105 S2 cells in each well of a 6 well plate in 1 mL/well of Schneider's medium supplemented with 10% Fetal Bovine Serum (FBS) and 100 U/mL Penicillin-Streptomycin.
    2. Add 7.5 µg of EGFP- or shams dsRNA to each well and incubate at 25 °C for 24 h.
    3. Harvest the control (EGFP dsRNA-treated) and shams dsRNA-treated S2 cells by gentle pipetting followed by pelleting down by centrifugation at 1,000 x g for 5 min at 25 °C and process for RNA isolation using an RNA extraction kit according to manufacturer's protocol.
    4. Quantify the RNA using a spectrophotometer and process 100 ng of RNA for 1-step qRT-PCR using commercial qPCR reagents and primer/probes and the following PCR thermal profile: Denaturation (95 °C, 15 s) and Annealing/Extension (60 °C, 1 min).
      NOTE: Please see the Table of Materials for information on the primer/probe sets and the instrument used for shams and control qRT-PCR experiments in these studies.
    5. Calculate relative shams mRNA levels using the 2-ΔΔCT method16.

2. Assessment of the Binding Between the Notch Receptor and Trans-ligands

  1. Prepare signal-receiving cells (S2 cells expressing the Notch receptor).
    1. Count the cells manually using a hemocytometer and plate 5 x 105 S2 and stable S2-Notch cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
      NOTE: For S2-Notch cells, which are available from Drosophila Genomics Resource Center (DGRC), add 200 nM methotrexate in media. To prepare a 0.5 mM methotrexate stock solution, first prepare a 20 mM methotrexate solution in 250 µL of 1 M NaOH. Next, dilute this solution to 0.5 mM in 1 M phosphate buffer saline and store at -20 °C. In S2-Notch cells, expression of the Notch protein is under the control of the Drosophila metallothionein promoter in the pMT vector.
    2. Add 7.5 µg of dsRNA to each well and incubate at 25 °C for 24 h.
    3. Add 0.7 mM CuSO4 to induce the expression of Notch and incubate at 25 °C for 3 days.
      NOTE: CuSO4 is used to induce expression of proteins controlled by the metallothionein promoter.
  2. Prepare signal-sending cells (S2 cell expressing Delta or Serrate ligands).
    1. Count the cells manually using a hemocytometer and plate ~5 x 106 stable S2-Delta or S2-SerrateTom cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
      NOTE: Add 200 nM methotrexate for S2-Delta cells and 100 µg/mL hygromycin for S2-SerrateTom cells in media. Expression of Delta and SerrateTom—a Tomato-tagged, functional version of Serrate12—is under Drosophila metallothionein promoter in the pMT vector.
    2. Add 0.7 mM CuSO4 to induce the expression of ligands and incubate at 25 °C for 3 h.
  3. Perform aggregation between signal-sending and signal-receiving cells.
    1. Harvest the dsRNA-treated S2 (control) and S2-Notch cells by gentle pipetting and plate 2.5 x 105 cells/well in a 24-well plate after manual counting by hemocytometer.
    2. Add 5 x 105 stable S2-Delta or S2-SerrateTom cells in a total volume of 200 µL of Schneider's medium (supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin).
      NOTE: All S2 cells handling (including plating, induction and dsRNA treatment) was done under a biosafety cabinet.
    3. Place the plate on an orbital shaker at 150 rpm (942.48 rad/min).
    4. After 1 min, mix the contents of each well and take 20 µL out for counting the number of aggregates.
      1. Simultaneously take a representative image under inverted compound microscope using 10x magnification (PLL 10/0.25 objective).
      2. Manually count the aggregates (>6 cells) using a hemocytometer.
    5. Place the plate on a shaker.
    6. Repeat the image acquisition and counting after 5 min and 15 min of aggregation.
  4. Perform quantification of trans-binding.
    1. Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-SerrateTom cells as a background control.
    2. Calculate the number of aggregates per mL between S2-Notch and S2-Delta or S2-SerrateTom cells (magnitude of trans-binding).

3. Evaluation of Inhibition of Binding Between Notch and Trans-ligands by Cis-ligands

  1. Prepare signal-receiving cells.
    1. Plate 5 x 105 S2 cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
    2. Add 7.5 µg of dsRNA to each well and incubate at 25 °C for 24 h.
    3. Co-transfect the dsRNA-treated cells with pBluescript and pMT-Notch11 (DGRC) alone or with pMT-Notch and pMT-Delta11 (DGRC) or pMT-Serrate17 for a total DNA concentration of 2 µg/well using a commercial transfection reagent according to manufacturer's protocol.
      NOTE: pBluescript is used as a control. The co-transfected cells will be called S2-Notch&Deltatransient or S2-Notch&Serratetransient cells hereafter.
    4. Incubate the transiently-transfected S2 cells at 25 °C for 24 h.
    5. Add 0.7 mM CuSO4 to induce the expression of Notch and the ligands and incubate at 25 °C for 3 days.
  2. Prepare signal-sending cells as described in 2.2.
  3. Perform aggregation between signal-sending and signal-receiving cells as described in section 2.3.
  4. Quantify inhibition of trans-binding by cis-ligands.
    1. Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-Serrate cells as a background control.
    2. Quantify the magnitude of inhibition by cis-ligands as follows.
      1. Define A as Number of aggregates between S2-Notchtransient and S2-Delta cells.
      2. Define B as Number of aggregates between S2 cells transiently co-transfected with Notch and Delta (S2-Notch&Deltatransient) and S2-Delta cells.
      3. Calculate relative aggregation C = (B x 100)/A
      4. Calculate magnitude of inhibition by cis-ligand (Delta or Serrate) as 100 – C.
        NOTE: As an example, if relative aggregation is 45%, then cis-ligands are considered to inhibit the trans-binding by 55%.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Our in vivo observations suggested that loss of the xylosyltransferase gene shams results in gain of Notch signaling due to increased Delta-mediated trans-activation of Notch without affecting the cis-inhibition of Notch by ligands8. To test this notion, in vitro cell aggregation assays were performed. First, shams expression in S2 cells was knocked down using shams dsRNA. EGFP dsRNA was used a...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Canonical Notch signaling depends on the interactions between the Notch receptor and its ligands5. Although most studies on the Notch pathway primarily consider the binding of Notch and ligands in neighboring cells (trans), Notch and same-cell ligands do interact, and these so-called cis-interactions can play an inhibitory role in Notch signaling3,4. Accordingly, to decipher the mechanisms underlying the effects of a modi...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have no conflict of interest.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors acknowledge support from the NIH/NIGMS (R01GM084135 to HJN) and Mizutani Foundation for Glycoscience (grant #110071 to HJN), and are grateful to Tom V. Lee for discussions and suggestions on the assays, and Spyros Artavanis-Tsakonas, Hugo Bellen, Robert Fleming, Ken Irvine and The Drosophila Genomics Resource Center (DGRC) for plasmids and cell lines.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
BioWhittaker Schneider’s Drosophila medium, ModifiedLonza04-351Q
HyClone Penicillin-Streptomycin 100X solutionGE Healthcare lifescience SV30010
CELLSTAR 6 well plateGreiner Bio-One657 160
CELLSTAR 24 well plateGreiner Bio-One662160
VWR mini shakerMarshell Sceintific12520-956
HemocytometerFisher Sceintific 267110
FuGENE HD Transfection ReagentPromegaE2311
MEGAscrip T7 Transcription KitAmbionAM1334
Quick-RNA MiniPrep (RNA purification Kit)Zymo ResearchR1054
VistaVision Inverted microscopeVWR
9MP USB2.0 Microscope Digital Camera + Advanced SoftwareAmScopeMU-900Image acquisition using ToupView software
PureLink Quick Gel Extraction KitInvitrogenK210012
Fetal Bovine SerumGenDepotF0600-050
MethotrexateSigma-AldrichA6770-10
Hygromycin BInvitrogenHY068-L6
Copper sulphateMacron Fine Chemicals4448-02
S2 cellsInvitrogenR69007
S2-SerrateTom cellsGift from R. Fleming (Fleming et al, Development, 2013)
S2-Delta cellsDGRC152
S2-Notch cellsDGRC154
pMT-Delta vectorDGRC1021Gift from S. Artavanis-Tsakonas
pMT-Serrate vectorGift from Ken Irvine (Okajima et al, JBC, 2003)
pMT-Notch vectorDGRC1022Gift from S. Artavanis-Tsakonas
pAc5.1-EGFPGift from Hugo Bellen
TaqMan RNA-to-Ct 1-Step KitApplied Biosystem1611091
TaqMan Gene Expression Assay for CG9996 (Shams)Applied BiosystemDm02144576_g1 with FAM-MGB dye
TaqMan Gene Expression Assay for CG7939 (RpL32)Applied BiosystemDm02151827_g1with FAM-MGB dye
Applied Biosystems 7900HT Fast Real-Time PCR systemApplied Biosystem435140596-well Block module

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. de Celis, J. F., Bray, S., Garcia-Bellido, A. Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development. 124 (10), 1919-1928 (1997).
  2. Fortini, M. E. Notch signaling: the core pathway and its posttranslational regulation. Dev Cell. 16 (5), 633-647 (2009).
  3. del Alamo, D., Rouault, H., Schweisguth, F. Mechanism and significance of cis-inhibition in Notch signalling. Curr Biol. 21 (1), R40-R47 (2011).
  4. Sprinzak, D., et al. Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature. 465 (7294), 86-90 (2010).
  5. Kopan, R., Ilagan, M. X. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell. 137 (2), 216-233 (2009).
  6. Huppert, S. S., Jacobsen, T. L., Muskavitch, M. A. Feedback regulation is central to Delta-Notch signalling required for Drosophila wing vein morphogenesis. Development. 124 (17), 3283-3291 (1997).
  7. Lee, T. V., et al. Negative regulation of notch signaling by xylose. PLoS Genet. 9 (6), e1003547(2013).
  8. Lee, T. V., Pandey, A., Jafar-Nejad, H. Xylosylation of the Notch receptor preserves the balance between its activation by trans-Delta and inhibition by cis-ligands in Drosophila. PLoS Genet. 13 (4), e1006723(2017).
  9. Jacobsen, T. L., Brennan, K., Arias, A. M., Muskavitch, M. A. Cis-interactions between Delta and Notch modulate neurogenic signalling in Drosophila. Development. 125 (22), 4531-4540 (1998).
  10. Schneider, I. Cell lines derived from late embryonic stages of Drosophila melanogaster. J Embryol Exp Morphol. 27 (2), 353-365 (1972).
  11. Fehon, R. G., et al. Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell. 61 (3), 523-534 (1990).
  12. Fleming, R. J., et al. An extracellular region of Serrate is essential for ligand-induced cis-inhibition of Notch signaling. Development. 140 (9), 2039-2049 (2013).
  13. Saj, A., et al. A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network. Dev Cell. 18 (5), 862-876 (2010).
  14. Fiuza, U. M., Klein, T., Martinez Arias, A., Hayward, P. Mechanisms of ligand-mediated inhibition in Notch signaling activity in Drosophila. Dev Dyn. 239 (3), 798-805 (2010).
  15. Ahimou, F., Mok, L. P., Bardot, B., Wesley, C. The adhesion force of Notch with Delta and the rate of Notch signaling. J Cell Biol. 167 (6), 1217-1229 (2004).
  16. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25 (4), 402-408 (2001).
  17. Okajima, T., Xu, A., Irvine, K. D. Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe. J Biol Chem. 278 (43), 42340-42345 (2003).
  18. Acar, M., et al. Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling. Cell. 132 (2), 247-258 (2008).
  19. Bruckner, K., Perez, L., Clausen, H., Cohen, S. Glycosyltransferase activity of Fringe modulates Notch-Delta interactions. Nature. 406 (6794), 411-415 (2000).
  20. Yamamoto, S., et al. A mutation in EGF repeat-8 of Notch discriminates between Serrate/Jagged and Delta family ligands. Science. 338 (6111), 1229-1232 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Notch SignalingCell Aggregation AssayTrans ActivationCis InhibitionDrosophila S2 CellsHemacytometer CountingOrbital ShakerInverted Compound MicroscopeDouble Stranded RNACopper Sulfate Induction

Related Articles