Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Summary

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Abstract

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of >6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Introduction

Canonical Notch signaling is a short-range cell to cell communication mechanism that requires physical contact of neighboring cells to facilitate the interaction between Notch receptors and their ligands¹. Interaction of Notch receptor (present on the surface of signal-receiving cells) with ligands (present on the surface of signal-sending cells) initiates Notch signaling and is known as trans-activation². On the other hand, interaction between Notch and its ligands in the same cell leads to the inhibition of Notch pathway and is known as cis-inhibition³. The balance between trans- and cis-interactions is required to ensure optimum ligand-dependent Notch signaling⁴. Drosophila has one Notch receptor and two ligands (Delta and Serrate) as opposed to mammals, which have four Notch receptors and five ligands [jagged 1 (JAG1), JAG2, delta-like 1 (DLL1), DLL3 and DLL4]⁵. Having this simplicity, the Drosophila model offers the ease to dissect/study the effects of pathway modifiers on Notch-ligand interactions and subsequently on Notch signaling. In certain contexts during animal development (including wing development in Drosophila), both cis- and trans-interactions are involved to achieve proper Notch signaling and cell fate^1,6. It is important to distinguish the effects of Notch pathway modifiers in these contexts on cis- versus trans-interactions of Notch with its ligands.

Our group previously reported that addition of a carbohydrate residue called xylose to Drosophila Notch negatively regulates Notch signaling in certain contexts, including wing development⁷. Loss of shams (the enzyme that xylosylates Notch) leads to a "loss of wing vein" phenotype⁷. More recently, gene dosage experiments and clonal analysis were used to show that loss of shams enhances Delta-mediated Notch singling. To distinguish whether the enhanced Notch signaling in shams mutants is a result of decreased cis-inhibition or increased trans-activation, ectopic overexpression studies of Notch ligands in larval wing imaginal discs using the dpp-GAL4 driver were performed. These experiments provided evidence suggesting that Shams regulates trans-activation of Notch by Delta without affecting Notch cis-inhibition by ligands⁸. However, feed-back regulations and effects of endogenous ligands might complicate the interpretation of ectopic overexpression studies^1,6,9.

To resolve this issue, Drosophila S2 cells¹⁰ were used, which provide a simple in vitro system for Notch-ligand interaction studies^11,12. S2 cells do not express endogenous Notch receptor and Delta ligand¹¹ and express a low level of Serrate¹³, which does not affect Notch-ligand aggregation experiments⁸. Therefore, S2 cells can be stably or transiently transfected by Notch and/or individual ligands (Delta or Serrate) to generate cells that exclusively express the Notch receptor or one of its ligands, or a combination of them. Mixing of Notch-expressing S2 cells with ligand-expressing S2 cells results in the formation of heterotypic aggregates mediated by receptor-ligand binding^11,12,14. Quantification of the aggregate formation provides a measure of trans-binding between Notch and its ligands¹⁵ (Figure 1). Similarly, S2 cells can be co-transfected with Notch and Delta or Serrate ligands (i.e. cis-ligands). Cis-ligands in these Notch-expressing S2 cells abrogate the binding of Notch with trans-ligands and result in decreased aggregate formation^8,12,14. The relative decrease in aggregate formation caused by cis-ligands provides a measure of the inhibitory effect of cis-ligands on binding between Notch and trans-ligands (Figure 2). Accordingly, cell aggregation assays were utilized to examine the effect of loss of xylosylation on trans- and cis-interactions between Notch and its ligands.

Here, we present a detailed protocol for cell aggregation assays aimed to evaluate the binding of Notch with trans-ligands and its inhibition by cis-ligands using Drosophila S2 cells. As an example, we provide the data that allowed us to determine the effect of Notch xylosylation on binding between Notch and trans-Delta⁸. These straightforward assays provide a semi-quantitative assessment of Notch-ligand interactions in vitro and help determine the molecular mechanisms underlying the in vivo effects of Notch pathway modifiers.

Protocol

1. Preparation of Double Stranded RNA (dsRNA) for Shams Knockdown

1. PCR amplification of the products
   1. Use wild-type yellow white (y w) genomic DNA and pAc5.1-EGFP as template and the following primer pairs to amplify the DNA fragments used in dsRNA synthesis. Use the following PCR thermal profile: Denaturation (95 °C, 30 s), Annealing (58 °C, 30 s) and Extension (72 °C, 1 min).
      Enhanced Green Fluorescent Protein (EGFP) dsRNA primers (5'-3')-
      Forward primer- GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG
      Reverse primer- GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG
      Shams dsRNA primers (5'-3')-
      Forward primer- TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT
      Reverse primer- TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA
      NOTE: EGFP dsRNA is used as negative control.
2. Gel-purify the polymerase chain reaction (PCR) products using a commercial gel purification kit according to manufacturer's protocol.
3. Perform in vitro transcription using a commercial product capable of transcribing from a T7 promoter according to manufacturer's protocol.
4. Purify the dsRNA using an RNA purification kit according to manufacturer's protocol and store at -80 °C.
5. Assess the efficiency of shams knockdown by using the following steps (1.5.1-1.5.5).
   1. Count the cells manually using a hemocytometer and plate 5 x 10⁵ S2 cells in each well of a 6 well plate in 1 mL/well of Schneider's medium supplemented with 10% Fetal Bovine Serum (FBS) and 100 U/mL Penicillin-Streptomycin.
   2. Add 7.5 µg of EGFP- or shams dsRNA to each well and incubate at 25 °C for 24 h.
   3. Harvest the control (EGFP dsRNA-treated) and shams dsRNA-treated S2 cells by gentle pipetting followed by pelleting down by centrifugation at 1,000 x g for 5 min at 25 °C and process for RNA isolation using an RNA extraction kit according to manufacturer's protocol.
   4. Quantify the RNA using a spectrophotometer and process 100 ng of RNA for 1-step qRT-PCR using commercial qPCR reagents and primer/probes and the following PCR thermal profile: Denaturation (95 °C, 15 s) and Annealing/Extension (60 °C, 1 min).
      NOTE: Please see the Table of Materials for information on the primer/probe sets and the instrument used for shams and control qRT-PCR experiments in these studies.
   5. Calculate relative shams mRNA levels using the 2^-ΔΔCT method¹⁶.

2. Assessment of the Binding Between the Notch Receptor and Trans-ligands

1. Prepare signal-receiving cells (S2 cells expressing the Notch receptor).
   1. Count the cells manually using a hemocytometer and plate 5 x 10⁵ S2 and stable S2-Notch cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
      NOTE: For S2-Notch cells, which are available from Drosophila Genomics Resource Center (DGRC), add 200 nM methotrexate in media. To prepare a 0.5 mM methotrexate stock solution, first prepare a 20 mM methotrexate solution in 250 µL of 1 M NaOH. Next, dilute this solution to 0.5 mM in 1 M phosphate buffer saline and store at -20 °C. In S2-Notch cells, expression of the Notch protein is under the control of the Drosophila metallothionein promoter in the pMT vector.
   2. Add 7.5 µg of dsRNA to each well and incubate at 25 °C for 24 h.
   3. Add 0.7 mM CuSO₄ to induce the expression of Notch and incubate at 25 °C for 3 days.
      NOTE: CuSO₄ is used to induce expression of proteins controlled by the metallothionein promoter.
2. Prepare signal-sending cells (S2 cell expressing Delta or Serrate ligands).
   1. Count the cells manually using a hemocytometer and plate ~5 x 10⁶ stable S2-Delta or S2-Serrate^Tom cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
      NOTE: Add 200 nM methotrexate for S2-Delta cells and 100 µg/mL hygromycin for S2-Serrate^Tom cells in media. Expression of Delta and Serrate^Tom—a Tomato-tagged, functional version of Serrate¹²—is under Drosophila metallothionein promoter in the pMT vector.
   2. Add 0.7 mM CuSO₄ to induce the expression of ligands and incubate at 25 °C for 3 h.
3. Perform aggregation between signal-sending and signal-receiving cells.
   1. Harvest the dsRNA-treated S2 (control) and S2-Notch cells by gentle pipetting and plate 2.5 x 10⁵ cells/well in a 24-well plate after manual counting by hemocytometer.
   2. Add 5 x 10⁵ stable S2-Delta or S2-Serrate^Tom cells in a total volume of 200 µL of Schneider's medium (supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin).
      NOTE: All S2 cells handling (including plating, induction and dsRNA treatment) was done under a biosafety cabinet.
   3. Place the plate on an orbital shaker at 150 rpm (942.48 rad/min).
   4. After 1 min, mix the contents of each well and take 20 µL out for counting the number of aggregates.
      1. Simultaneously take a representative image under inverted compound microscope using 10x magnification (PLL 10/0.25 objective).
      2. Manually count the aggregates (>6 cells) using a hemocytometer.
   5. Place the plate on a shaker.
   6. Repeat the image acquisition and counting after 5 min and 15 min of aggregation.
4. Perform quantification of trans-binding.
   1. Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-Serrate^Tom cells as a background control.
   2. Calculate the number of aggregates per mL between S2-Notch and S2-Delta or S2-Serrate^Tom cells (magnitude of trans-binding).

3. Evaluation of Inhibition of Binding Between Notch and Trans-ligands by Cis-ligands

1. Prepare signal-receiving cells.
   1. Plate 5 x 10⁵ S2 cells in each well of a 6-well plate in 1 mL/well of Schneider's medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.
   2. Add 7.5 µg of dsRNA to each well and incubate at 25 °C for 24 h.
   3. Co-transfect the dsRNA-treated cells with pBluescript and pMT-Notch¹¹ (DGRC) alone or with pMT-Notch and pMT-Delta¹¹ (DGRC) or pMT-Serrate¹⁷ for a total DNA concentration of 2 µg/well using a commercial transfection reagent according to manufacturer's protocol.
      NOTE: pBluescript is used as a control. The co-transfected cells will be called S2-Notch&Delta^transient or S2-Notch&Serrate^transient cells hereafter.
   4. Incubate the transiently-transfected S2 cells at 25 °C for 24 h.
   5. Add 0.7 mM CuSO₄ to induce the expression of Notch and the ligands and incubate at 25 °C for 3 days.
2. Prepare signal-sending cells as described in 2.2.
3. Perform aggregation between signal-sending and signal-receiving cells as described in section 2.3.
4. Quantify inhibition of trans-binding by cis-ligands.
   1. Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-Serrate cells as a background control.
   2. Quantify the magnitude of inhibition by cis-ligands as follows.
      1. Define A as Number of aggregates between S2-Notch^transient and S2-Delta cells.
      2. Define B as Number of aggregates between S2 cells transiently co-transfected with Notch and Delta (S2-Notch&Delta^transient) and S2-Delta cells.
      3. Calculate relative aggregation C = (B x 100)/A
      4. Calculate magnitude of inhibition by cis-ligand (Delta or Serrate) as 100 – C.
         NOTE: As an example, if relative aggregation is 45%, then cis-ligands are considered to inhibit the trans-binding by 55%.

Results

Our in vivo observations suggested that loss of the xylosyltransferase gene shams results in gain of Notch signaling due to increased Delta-mediated trans-activation of Notch without affecting the cis-inhibition of Notch by ligands⁸. To test this notion, in vitro cell aggregation assays were performed. First, shams expression in S2 cells was knocked down using shams dsRNA. EGFP dsRNA was used a...

Discussion

Canonical Notch signaling depends on the interactions between the Notch receptor and its ligands⁵. Although most studies on the Notch pathway primarily consider the binding of Notch and ligands in neighboring cells (trans), Notch and same-cell ligands do interact, and these so-called cis-interactions can play an inhibitory role in Notch signaling^3,4. Accordingly, to decipher the mechanisms underlying the effects of a modi...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
BioWhittaker Schneider’s Drosophila medium, Modified	Lonza	04-351Q
HyClone Penicillin-Streptomycin 100X solution	GE Healthcare lifescience	SV30010
CELLSTAR 6 well plate	Greiner Bio-One	657 160
CELLSTAR 24 well plate	Greiner Bio-One	662160
VWR mini shaker	Marshell Sceintific	12520-956
Hemocytometer	Fisher Sceintific	267110
FuGENE HD Transfection Reagent	Promega	E2311
MEGAscrip T7 Transcription Kit	Ambion	AM1334
Quick-RNA MiniPrep (RNA purification Kit)	Zymo Research	R1054
VistaVision Inverted microscope	VWR
9MP USB2.0 Microscope Digital Camera + Advanced Software	AmScope	MU-900	Image acquisition using ToupView software
PureLink Quick Gel Extraction Kit	Invitrogen	K210012
Fetal Bovine Serum	GenDepot	F0600-050
Methotrexate	Sigma-Aldrich	A6770-10
Hygromycin B	Invitrogen	HY068-L6
Copper sulphate	Macron Fine Chemicals	4448-02
S2 cells	Invitrogen	R69007
S2-SerrateTom cells			Gift from R. Fleming (Fleming et al, Development, 2013)
S2-Delta cells	DGRC	152
S2-Notch cells	DGRC	154
pMT-Delta vector	DGRC	1021	Gift from S. Artavanis-Tsakonas
pMT-Serrate vector			Gift from Ken Irvine (Okajima et al, JBC, 2003)
pMT-Notch vector	DGRC	1022	Gift from S. Artavanis-Tsakonas
pAc5.1-EGFP			Gift from Hugo Bellen
TaqMan RNA-to-Ct 1-Step Kit	Applied Biosystem	1611091
TaqMan Gene Expression Assay for CG9996 (Shams)	Applied Biosystem	Dm02144576_g1	with FAM-MGB dye
TaqMan Gene Expression Assay for CG7939 (RpL32)	Applied Biosystem	Dm02151827_g1	with FAM-MGB dye
Applied Biosystems 7900HT Fast Real-Time PCR system	Applied Biosystem	4351405	96-well Block module