Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Summary

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Abstract

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of >6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Introduction

Canonical Notch signaling is a short-range cell to cell communication mechanism that requires physical contact of neighboring cells to facilitate the interaction between Notch receptors and their ligands¹. Interaction of Notch receptor (present on the surface of signal-receiving cells) with ligands (present on the surface of signal-sending cells) initiates Notch signaling and is known as trans-activation². On the other hand, interaction between Notch and its ligands in the same cell leads to the inhibition of Notch pathway and is known as cis-inhibition³. The balance between ....

Protocol

1. Preparation of Double Stranded RNA (dsRNA) for Shams Knockdown

1. PCR amplification of the products
   1. Use wild-type yellow white (y w) genomic DNA and pAc5.1-EGFP as template and the following primer pairs to amplify the DNA fragments used in dsRNA synthesis. Use the following PCR thermal profile: Denaturation (95 °C, 30 s), Annealing (58 °C, 30 s) and Extension (72 °C, 1 min).
      Enhanced Green Fluorescent Protein (EGFP) dsRNA primers (5'-3')-
      Forward primer- GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG
      Reverse primer- GAAATTAATACGA....

Results

Our in vivo observations suggested that loss of the xylosyltransferase gene shams results in gain of Notch signaling due to increased Delta-mediated trans-activation of Notch without affecting the cis-inhibition of Notch by ligands⁸. To test this notion, in vitro cell aggregation assays were performed. First, shams expression in S2 cells was knocked down using shams dsRNA. EGFP dsRNA was used a.......

Discussion

Canonical Notch signaling depends on the interactions between the Notch receptor and its ligands⁵. Although most studies on the Notch pathway primarily consider the binding of Notch and ligands in neighboring cells (trans), Notch and same-cell ligands do interact, and these so-called cis-interactions can play an inhibitory role in Notch signaling^3,4. Accordingly, to decipher the mechanisms underlying the effects of a modi.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
BioWhittaker Schneider’s Drosophila medium, Modified	Lonza	04-351Q
HyClone Penicillin-Streptomycin 100X solution	GE Healthcare lifescience	SV30010
CELLSTAR 6 well plate	Greiner Bio-One	657 160
CELLSTAR 24 well plate	Greiner Bio-One	662160
VWR mini shaker	Marshell Sceintific	12520-956
Hemocytometer	Fisher Sceintific	267110
FuGENE HD Transfection Reagent	Promega	E2311
MEGAscrip T7 Transcription Kit	Ambion	AM1334
Quick-RNA MiniPrep (RNA purification Kit)	Zymo Research	R1054
VistaVision Inverted microscope	VWR
9MP USB2.0 Microscope Digital Camera + Advanced Software	AmScope	MU-900	Image acquisition using ToupView software
PureLink Quick Gel Extraction Kit	Invitrogen	K210012
Fetal Bovine Serum	GenDepot	F0600-050
Methotrexate	Sigma-Aldrich	A6770-10
Hygromycin B	Invitrogen	HY068-L6
Copper sulphate	Macron Fine Chemicals	4448-02
S2 cells	Invitrogen	R69007
S2-SerrateTom cells			Gift from R. Fleming (Fleming et al, Development, 2013)
S2-Delta cells	DGRC	152
S2-Notch cells	DGRC	154
pMT-Delta vector	DGRC	1021	Gift from S. Artavanis-Tsakonas
pMT-Serrate vector			Gift from Ken Irvine (Okajima et al, JBC, 2003)
pMT-Notch vector	DGRC	1022	Gift from S. Artavanis-Tsakonas
pAc5.1-EGFP			Gift from Hugo Bellen
TaqMan RNA-to-Ct 1-Step Kit	Applied Biosystem	1611091
TaqMan Gene Expression Assay for CG9996 (Shams)	Applied Biosystem	Dm02144576_g1	with FAM-MGB dye
TaqMan Gene Expression Assay for CG7939 (RpL32)	Applied Biosystem	Dm02151827_g1	with FAM-MGB dye
Applied Biosystems 7900HT Fast Real-Time PCR system	Applied Biosystem	4351405	96-well Block module