Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Summary

This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Abstract

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the disordered and protease labile C-terminus of the protein. This manuscript describes the methods to purify recombinant Nsa1 from S. cerevisiae for structural analysis by both X-ray crystallography and SAXS. X-ray crystallography was utilized to solve the structure of the well-ordered N-terminal WD40 domain of Nsa1, and then SAXS was used to resolve the structure of the C-terminus of Nsa1 in solution. Solution scattering data was collected from full-length Nsa1 in solution. The theoretical scattering amplitudes were calculated from the high-resolution crystal structure of the WD40 domain, and then a combination of rigid body and ab initio modeling revealed the C-terminus of Nsa1. Through this hybrid approach the quaternary structure of the entire protein was reconstructed. The methods presented here should be generally applicable for the hybrid structural determination of other proteins composed of a mix of structured and unstructured domains.

Introduction

Ribosomes are large ribonucleoprotein machines that carry out the essential role of translating mRNA into proteins in all living cells. Ribosomes are composed of two subunits which are produced in a complex process termed ribosome biogenesis^1,2,3,4. Eukaryotic ribosome assembly relies on the aid of hundreds of essential ribosomal assembly factors^2,3,5. Nsa1 (Nop7 associated 1) is a eukaryotic ribosome assembly factor that is specifically required fo....

Protocol

1. Recombinant Protein Production and Purification of Nsa 1

1. Nsa1 Expression Plasmid Design and Cloning
   1. Obtain or purchase S. cerevisiae genomic DNA.
   2. PCR amplify the target sequences of Nsa1 (Nsa1_FL, residues 1-463) and C-terminal truncated Nsa1 (Nsa1_ΔC, residues 1-434) with appropriate primers using genomic DNA isolated from S. cerevisiae and a melting temperature of approximately 60 °C with an extension time of 1-2 min. The following primers were used to amplify Nsa1:
      SC_Nsa1_FLFw:CGCCAAAGGCCTATGAGGTTACTAGTCAGCTGTGTGGATAG
      SC_Nsa1_FLRv:AATGCAGCGGCCGCTCAAATTTTGCTTTTCTTA....

Results

Nsa1 was PCR amplified from S. cerevisiae genomic DNA and subcloned into a vector containing an N-terminal 6x-Histidine affinity tag followed by MBP and a TEV protease site. Nsa1 was transformed into E. coli BL21(DE3) cells and high yields of protein expression were obtained following induction with IPTG and growth at 25 °C overnight (Figure 1A). Nsa1 was affinity-purified on immobilized cobalt affinity resin, followed by MBP cleavage with T.......

Discussion

Using this protocol, recombinant Nsa1 from S. cerevisiae was generated for structural studies by both X-ray crystallography and SAXS. Nsa1 was well-behaved in solution and crystallized in multiple crystal forms. During the optimization of these crystals, it was discovered that the C-terminus of Nsa1 was sensitive to protease degradation. The high resolution, orthorhombic crystal form could only be duplicated with C-terminal truncation variants of Nsa1, likely because the flexible C-terminus of Nsa1 prevented cry.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Molecular Cloning of Nsa1
pMBP2 parallel vector	Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)		We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)
S. cerevisiae genomic DNA	ATCC	204508D-5
Primers for cloning Nsa1
SC_Nsa1_FLFw	IDT		CGC CAA AGG CCT ATGAGGTTACTAGTCAGCTGTGT GGATAG
SC_Nsa1_FLRv	IDT		AATGCAGCGGCCGCTCAAATTTT GCTTTTCTTACTGGCTTTAGAAGC AGC
SC_Nsa1_DeltaCFw	IDT		GGGCGCCATGGGATCCATGAGG TTACTAGTCAGCTGTGTGG
SC_Nsa1_DeltaCRv	IDT		GATTCGAAAGCGGCCGCTTAAAC CTTCCTTTTTTGCTTCCC
Recombinant Protein Production and Purification of Nsa1
Escherichia coli BL21 (DE3) Star Cells	Invitrogen	C601003
pMBP- NSA1 and various truncations	Lo et al., 2017
Selenomethionine	Molecular Dimensions	MD12-503B
IPTG, Dioxane-Free	Promega	V3953
EDTA Free Protease Inhibitor Cocktail	Sigma-Aldrich	4693159001
Sodium Chloride	Caledon Laboratory Chemicals	7560-1-80
Magnesium Chloride hexahydrate	Sigma-Aldrich	M2670
Tris Buffer, 1 M pH7.5	KD Medical	RGF-3340
Glycerol	Invitrogen	15514-029
beta-mercaptoethanol	Sigma	M6250
1M Imidazole, pH 8.0	Teknova	I6980-06
Talon Affinity Resin	Clonetech	635503
Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)	Millipore	UFC901024
HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column	GE-Healthcare	28989335
TEV Protease	Prepared by NIEHS Protein Expression Core	Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)
4-15% Mini-PROTEAN TGX Precast Protein Gels	BioRad	456-8056
Crystallization, Proteolytic Screening
Crystal Screen	Hampton Research	HR2-110
Crystal Screen 2	Hampton Research	HR2-112
Salt Rx	Hampton Research	HR2-136
Index Screen	Hampton Research	HR2-144
PEG/Ion Screen	Hampton Research	HR2-139
JCSG+	Molecular Dimensions	MD1-37
Wizard Precipitant Synergy	Molecular Dimensions	MD15-PS-T
Swissci 96-well 3-drop UVP sitting drop plates	TTP Labtech	4150-05823
3inch Wide Crystal Clear Sealing Tape	Hampton Research	HR4-506
Proti-Ace Kit	Hampton Research	HR2-429
PEG 1500	Molecular Dimensions	MD2-100-6
PEG 400	Molecular Dimensions	MD2-100-3
HEPES/sodium hydroxide pH 7.5	Molecular Dimensions	MD2-011-
Sodium Citrate tribasic	Molecular Dimensions	MD2-100-127
22 mm x 0.22 mm Siliconized Coverslides	Hampton Research	HR3-231
24 Well Plates with sealant (VDX Plate with Sealant)	Hampton Research	HR3-172
18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)	Hampton Research	HR4-945, HR4-947, HR4-970, HR4-971
Seed Bead Kit	Hampton Research	HR2-320
Magnetic Crystal Caps	Hampton Research	HR4-779
Magnetic Cryo Wand	Hampton Research	HR4-729
Cryogenic Foam Dewar	Hampton Research	HR4-673
Crystal Puck System	MiTeGen	M-CP-111-021
Full Skirt 96 well Clear Plate	VWR	10011-228
AxyMat Sealing Mat	VWR	10011-130
Equipment
UVEX-m	JAN Scientific, Inc.
Nanodrop Lite Spectrophotometer	Thermo-Fisher
Mosquito Robot	TTP Labtech
Software/Websites
HKL2000	Otwinoski and Minor, 1997
Phenix	Adams et al., 2010
Coot	Emsley et al., 2010
ATSAS	Petoukhov et al., 2012		https://www.embl-hamburg.de/biosaxs/atsas-online/
Scatter	Rambo and Tainer, 2013
Pymol	The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC.
BUNCH	Petoukhov and Svergun, 2005
CRYSOL	Svergun et al, 1995
PRIMUS	Konarev et al, 2003
EOM	Tria et al, 2015