A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

8.5K views

⸱

DOI:

10.3791/56981

⸱

October 3rd, 2018

In This Article

Summary

The protocols described allow the construction, characterization and selection (against the target of choice) of a "domainome" library made from any DNA source. This is achieved by a research pipeline that combines different technologies: phage display, a folding reporter and next generation sequencing with a web tool for data analysis.

Abstract

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to poorly folding proteins or random open reading frames. We have developed a strategy where, by using TEM-1 β-lactamase (the enzyme conferring ampicillin resistance) on a genomic scale, we can select collections of correctly folded protein domains from the coding portion of the DNA of any intronless genome. The protein fragments obtained by this approach, the so called "domainome", will be well expressed and soluble, making them suitable for structural/functional studies.

By cloning and displaying the "domainome" directly in a phage display system, we have showed that it is possible to select specific protein domains with the desired binding properties (e.g., to other proteins or to antibodies), thus providing essential experimental information for gene annotation or antigen identification.

The identification of the most enriched clones in a selected polyclonal population can be achieved by using novel next-generation sequencing technologies (NGS). For these reasons, we introduce deep sequencing analysis of the library itself and the selection outputs to provide complete information on diversity, abundance and precise mapping of each of the selected fragment. The protocols presented here show the key steps for library construction, characterization, and validation.

Introduction

Here, we describe a high-throughput method for the construction and selection of libraries of folded and soluble protein domains from any genic/genomic starting source. The approach combines three different technologies: phage display, the use of a folding reporter and next generation sequencing (NGS) with a specific web tool for data analysis. The methods can be used in many different contexts of protein-based research, for identification and annotation of new proteins/protein domains, characterization of structural and functional properties of known proteins as well as definition of protein-interaction network.

Many open questions are still present in protein-based research and the development of methods for optimal protein production is an important need for several fields of investigation. For example, despite the availability of thousands of prokaryotic and eukaryotic genomes1, a corresponding map of the relative proteomes with a direct annotation of the coded proteins and peptides is still missing for the great majority of organisms. The catalogue of complete proteomes is emerging as a challenging goal requiring a huge effort in terms of time and resources. The gold standard for experimental annotation remains the cloning of all the Open Reading Frames (ORFs) of a genome, building the so called "ORFeome". Usually gene function is assigned based on homology to related genes of known activity but this approach is poorly accurate due to the presence of many incorrect annotations in the reference databases2,3,4,5. Moreover, even for proteins that have been identified and annotated, additional studies are required to achieve characterization in terms of abundance, expression patterns in different contexts, including structural and functional properties as well as interaction networks.

Furthermore, since proteins are composed of different domains, each of them showing specific features and differently contributing to protein functions, the study and the exact definition of these domains can allow a more comprehensive picture, both at the single gene and at the full genome level. All this necessary information makes protein-based research a wide and challenging field.

In this perspective, an important contribution could be given by unbiased and high-throughput methods for protein production. However, the success of such approaches, beside the considerable investment required, relies on the ability to produce soluble/stable protein constructs. This is a major limiting factor since it has been estimated that only about 30% of proteins can be successfully expressed and produced at sufficient levels to be experimentally useful6,7,8. An approach to overcome this limitation is based on the use of randomly fragmented DNA to produce different polypeptides, which together provide overlapping fragment representation of individual genes. Only a small percentage of the randomly generated DNA fragments are functional ORFs whilst the great majority of them are non-functional (due to the presence of stop codons inside their sequences) or encode for un-natural (ORF in a frame other than the original) polypeptides with no biological meaning.

To address all these issues, our group has developed an high-throughput protein expression and interaction analysis platform that can be used on a genomic scale9,10,11,12. This platform integrates the following techniques: 1) a method to select collections of correctly folded protein domains from the coding portion of DNA from any organism; 2) the phage display technology for selecting partners of interactions; 3) the NGS to completely characterize the whole interactome under study and identify the clones of interest; and 4) a web tool for data analysis for users without any bioinformatics or programming skills to perform Interactome-Seq analysis in an easy and user-friendly way.

The use of this platform offers important advantages over alternative strategies of investigation; above all the method is completely unbiased, high-throughput, and modular for study ranging from a single gene up to a whole genome. The first step of the pipeline is the creation of a library from randomly fragmented DNA under study, which is then deeply characterized by NGS. This library is generated using an engineered vector where genes/fragments of interest are cloned between a signal sequence for protein secretion into the periplasmic space (i.e., a Sec leader) and the TEM1 β-lactamase gene. The fusion protein will confer ampicillin resistance and the ability to survive under ampicillin pressure only if cloned fragments are in-frame with both these elements and the resulting fusion protein is correctly folded10,13,14. All clones rescued after antibiotic selection, the so called "filtered clones", are ORFs and, a great majority of them (more than 80%), are derived from real genes9. Moreover, the power of this strategy lies in the findings that all ORF filtered clones are encoding for correctly folded/soluble proteins/domains15. As many clones, present in the library and mapping in the same region/domain, have different starting and ending points, this allows unbiased, single-step identification of the minimum fragments that are likely to result in soluble products.

A further improvement in the technology is given by the use of NGS to characterize the library. The combination of this platform and of a specific web tool for data analysis gives important unbiased information on the exact nucleotide sequences and on the location of selected ORFs on the reference DNA under study without the need of further extensive analyses or experimental effort.

Domainome libraries can be transferred into a selection context and used as a universal instrument to perform functional studies. The high-throughput protein expression and interaction analysis platform that we integrated and that we called Interactome-Seq takes advantage of the phage display technology by transferring the filtered ORF into a phagemid vector and creating a phage-ORF library. Once re-cloned into a phage display context, protein domains are displayed on the surface of M13 particles; in this way domainome libraries can be directly selected for gene fragments encoding domains with specific enzymatic activities or binding properties, allowing interactome networks profiling. This approach was initially described by Zacchi et al.16 and later used in several other context13,17,18.

Compared to other technologies used to study protein-protein interaction (including yeast two hybrid system and mass spectrometry19,20), one major advantage is the amplification of the binding partner that occurs during phage display multiple rounds of selection. This increases the selection sensitivity thus allowing the identification of low abundant binding proteins' domains present in the library. The efficiency of the selection performed with ORF-filtered library is further increased due to the absence of non-functional clones. Finally, the technology allows the selection to be performed against both protein and non-protein baits21,22,23,24,25.

Phage selections using the domainome-phage library can be performed using antibodies coming from sera of patients with different pathological conditions, e.g. autoimmune diseases13, cancer or infection diseases as bait. This approach is used to obtain the so called "antibody signature" of the disease under study allowing to massively identify and characterize the antigens/epitopes specifically recognized by the patients' antibodies at the same time. Compared to other methods the use of phage display allows the identification of both linear and conformational antigenic epitopes. The identification of a specific signature could potentially have an important impact for understanding pathogenesis, new vaccine design, identification of new therapeutic targets and development of new and specific diagnostic and prognostic tools. Moreover, when the study is focused on infectious diseases, a major advantage is that the discovery of immunogenic proteins is independent from pathogen cultivation.

Our approach confirms that the folding reporters can be used on a genomic scale to select the "domainome": a collection of correctly folded, well expressed, soluble protein domains from the coding portion of the DNA and/or cDNA from any organism. Once isolated the protein fragments are useful for many purposes, providing essential experimental information for gene annotation as well as for structural studies, antibody epitope mapping, antigen identification, etc. The completeness of high-throughput data provided by NGS enables the analysis of highly complex samples, such as phage display libraries, and holds the potential to circumvent the traditional laborious picking and testing of individual phage rescued clones.

At the same time thanks to the features of the filtered library and to the extreme sensitivity and power of the NGS analysis, it is possible to identify the protein domain responsible of each interaction directly in an initial screen, without the need to create additional libraries for each bound protein. NGS allows to obtain a comprehensive definition of the whole domainome of any genic/genomic starting source and the data analysis web tool enables the obtainment of a highly specific characterization both from a qualitative and quantitative point of view of the interactome proteins' domains.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Construction of the ORF Library (Figure 1)

  1. Preparation of insert DNA
    1. Fragments preparation from synthetic or genomic DNA
      1. Extract/purify DNA using standard methods26.
      2. Fragment DNA by sonication. If using a standard sonicator, as a general suggestion start with 30 s pulses at 100% power output.
        NOTE: Pilot experiments should be done with different power and sonication times to set the optimal conditions for the DNA preparation. After each test determine the size of the DNA fragments by agarose gel electrophoresis.
      3. Load the sonicated DNA onto 1.5% agarose gel, together with a 100 bp DNA ladder. Perform a short electrophoresis run at 5 V/cm for 15 min and cut the portion of the gel containing the smear of the fragmented DNA.
      4. Purify the insert DNA with a column-based gel extraction kit and measure the concentration using an UV spectrophotometer.
        NOTE: At least 500 ng of purified inserts should be obtained after this step, to be ligated with 1 µg of digested vector, as described in step 1.3. Check quality of fragments preparation by evaluating A260nm/A280nm and A260nm/A230nm ratios since low quality of the sample will affect the ligation efficiency.
      5. Treat up to 5 μg of the inserts with 1 μL of the Quick Blunting Kit enzyme mix, according to manufacturer's instructions. Inactivate enzymes by heating at 70 °C for 10 min. Samples can be stored at -20 °C until use.
    2. Fragments preparation from cDNA
      1. Extract RNA with standard methods (e.g., using TRizol or similar reagents).
      2. Fragment mRNA by heating prior to performing reverse transcription. The final DNA fragment length is controlled by mRNA boiling time and random primer concentration. For example, heat sample for 6 min at 95 °C.
      3. Prepare cDNA using random primers with any available kit following the manufacturer's protocol.
      4. Deplete cDNA of poly-dT tails by hybridization with biotinylated poly-dA for 3 h at 37 °C, and separate on streptavidin magnetic beads as described by Carninci et al.13
      5. Recover unbound material and purify with a column-based DNA purification kit following the manufacturer's instructions. Measure the concentration using an UV spectrophotometer. See Note in step 1.1.1.4.
  2. Preparation of the filtering vector
    1. Digest 5 µg of purified cloning vector pFILTER312 with 10 U of EcoRV restriction enzyme, following manufacturer's protocol.
    2. Load 2 µL (200 ng) of the digested vector, together with 100 ng of the undigested vector and 1k bp molecular marker, on a 1% agarose gel, to check for proper digestion. Heat inactivate the restriction enzyme.
    3. Add 1/10 volume of 10x phosphatase buffer and 1 µL (5 U) of phosphatase and incubate at 37 °C for 15 min. Heat inactivate for 5 min at 65 °C.
    4. Purify digested plasmid by extraction from agarose gel, and measure the concentration using an UV spectrophotometer. Samples can be stored at -20 °C until use.
  3. Ligation and transformation
    1. Perform ligation as follows: for 1 µg of digested plasmid add 400 ng of phosphorylated inserts (plasmid:insert molar ratio 1:5), 10 µL of 10x Buffer for T4 DNA Ligase, 2 µL of high concentration T4 DNA ligase in a final volume of 100 µL. Incubate the reaction at 16 °C overnight. Heat inactivate at 65 °C for 10 min.
    2. Precipitate the ligation product by adding 1/10 volume of sodium acetate solution (3 M, pH 5.2) and 2.5 volumes of 100% ethanol. Mix and freeze at -80 °C for 20 min.
    3. Centrifuge at maximum speed for 20 min at 4 °C. Discard the supernatant.
    4. Add 500 µL of cold 70% ethanol to the pellet and centrifuge at maximum speed for 20 min at 4 °C. Discard the supernatant.
    5. Air dry the pellet. Resuspend the precipitated DNA into 10 µL of water.
    6. Perform bacterial cell electroporation.
      NOTE: The use of high-efficiency cells (above 5x109 transformants per µg of DNA) is required. We suggest using Escherichia coli DH5αF' (F'/endA1 hsd17 (rK − mK+) supE44 thi-1recA1 gyrA (Nalr) relA1 (lacZYA-argF) U169 deoR (F80dlacD-(lacZ)M15) produced in house or purchased from several manufacturers.
      1. Place appropriate number of microcentrifuge tubes and 0.1 cm-electroporation cuvettes on ice. Add 1 µL of purified ligation solution (in DI water) to 25 µL of the cells and flick the tube a few times.
      2. Transfer the DNA-cell mixture to the cold cuvette, tap on countertop 2x, wipe water from exterior of cuvette, place in the electroporation module and press pulse.
      3. Perform electroporation with a standard electroporator machine using 25 µF, 200 Ω and 1.8 kV. Time constant must be 4-5 ms.
    7. Immediately add 1 mL of liquid 2xYT medium without any antibiotic, transfer to a 10 mL tube and allow to grow at 37 °C, shaking at 220 rpm for 1 h.
    8. Plate transformed DH5αF' on 15 cm 2xYT agar plates supplemented with 34 µg/mL chloramphenicol (pFILTER resistance) and 25 µg/mL ampicillin (selective marker for ORFs) and incubate overnight at 30 °C.
    9. Plate dilutions of the library on 10 cm 2xYT agar plates supplemented with chloramphenicol + ampicillin and with chloramphenicol only, to perform library titration. Incubate overnight at 30 °C.
  4. pFILTER-ORF library validation
    1. Test 15-20 colonies from both chloramphenicol and chloramphenicol/ampicillin plates to estimate insert size distribution. Pick single colonies with a tip and dilute them separately in 100 µL of 2xYT medium without antibiotics. Use 0.5 µL of this solution as DNA template for a PCR reaction, with any standard TaqDNA polymerase following manufacturer's protocol.
    2. Perform 25 cycles of amplification using a T annealing of 55 °C and an extension time of 40 s at 72 °C. Primer sequences are provided in the Table of Materials.
    3. Load the PCR products on 1.5% agarose gel, together with a 100 bp DNA ladder and run.
  5. pFILTER-ORF library collection
    1. Collect bacteria from the 150 mm plates by adding 3 mL of fresh 2xYT medium and harvesting them with a sterile scraper, mix thoroughly, supplement them with 20% sterile glycerol and store at -80 °C in small aliquots.
    2. Purify plasmid DNA from one aliquot of the library (before the addition of glycerol) using a column-based plasmid extraction kit, following manufacturer's instructions.
    3. Measure the concentration with the UV spectrophotometer. Samples can be stored at -20 °C until be used for phagemid library preparation and/or characterization by NGS.

2. Subcloning of Filtered ORFs in a Phagemid Vector (Figure 2)

  1. Preparation of ORF filtered DNA fragments
    1. Set up restriction enzyme digestion of 5 µg of purified vector from the pFILTER-ORF library vector adding 10 U of BssHII and incubating as per manufacturer's protocol. Inactivate the enzyme and digest with 10 U of NheI.
    2. Load the digested DNA onto 1.5% agarose gel, together with a 100 bp DNA ladder. Perform a short electrophoresis run at 5 V/cm for 15 min or just enough to distinguish the smear of excised fragments and cut the portion of the gel containing them.
    3. Purify the insert DNA with a column-base gel extraction kit and measure the concentration using an UV spectrophotometer.
  2. Preparation of phagemid DNA
    1. Set up restriction enzyme digestion of 5 µg of purified pDAN527 as for the inserts.
    2. Purify digested plasmid by running digested DNA on a 0.75% agarose gel and extract from gel with a column-based kit.
    3. Measure the concentration using an UV spectrophotometer. Samples can be stored at -20 °C until use.
  3. Library ligation, transformation and collection
    1. Perform ligation and transformation as described for pFILTER vector.
    2. Plate transformed DH5αF' on 150 mm 2xYT agar plates supplemented with 100 µg/mL ampicillin and incubate overnight at 30 °C.
    3. Plate dilutions of the library on 100 mm 2xYT agar plates supplemented with 100 µg/mL ampicillin to determine the library size.
    4. Perform library validation by PCR of randomly picked clones as described in step 1.4.
    5. Collect the phagemid-ORF library by harvesting bacteria from 150 mm plates, mix thoroughly, supplement them with 20% sterile glycerol and store at -80 °C in small aliquots .
    6. Purify plasmid DNA from one aliquot of the library using a column-based plasmid extraction kit, following manufacturer's instructions.
    7. Measure the concentration at the UV spectrophotometer. Samples can be stored at -20 °C until be used for characterization by NGS.

3. Phage Library Preparation and Selection Procedure

  1. Phage production
    1. Dilute a stock aliquot of the phagemid library into 10 mL of 2xYT liquid broth supplemented with 100 µg/mL ampicillin in order to have an OD600nm = 0.05.
    2. Grow the diluted library in a sterile flask 5-10 times bigger than the original volume, at 37 °C with shaking at 220 rpm until reaches OD600nm = 0.5.
    3. Infect bacteria with helper phage (e.g. M13K07) at a multiplicity of infection 20:1. Leave at 37 °C for 45 min with occasional agitation (every 10 min).
    4. Centrifuge bacteria at 4000 x g for 10 min at room temperature. Discard supernatant, re-suspend bacteria pellet in 40 mL of 2xYT liquid broth supplemented with 100 µg/mL ampicillin and 50 µg/mL kanamycin and grow at 28 °C with shaking at 220 rpm for overnight.
    5. The day after, centrifuge bacteria at 4000 x g for 20 min at 4 °C. Collect the supernatant containing phages.
  2. PEG-precipitation of phages.
    1. Add 1/5 volume of a 0.22 µm filtered PEG/NaCl solution (20% w/v PEG 6000, 2.5 M NaCl) to the cleared phages and incubate on ice for 30-60 min.
      NOTE: Solution became smoky after few minutes, indicating a successful phage precipitation. The cloudiness of the solution will increase over the incubation time.
    2. Centrifuge at 4000 x g for 15 min at 4 °C. A white small pellet of phages will form.
    3. Resuspend it in 1 mL of sterile PBS. Transfer to 1.5 mL tube and centrifuge at 4 °C for 10 min at maximum speed to remove contaminant bacteria. A brown pellet will form.
    4. Transfer supernatant containing phages to a new tube. Keep phages on ice for successive titration and phage selection.
  3. Phage titration
    1. Prepare serial dilutions of the phage solution. Put 10 µL of the phage solution in 990 µL of PBS to obtain 10-2 dilution. Dilute again this preparation to make 10-4 and from this obtain a 10-6 dilution.
    2. Grow DH5αF' bacteria cells into 2xYT liquid medium at 37 °C with shaking until OD600nm = 0.5 is reached. Transfer 1 mL of the prepared bacteria into 1.5 mL tube and immediately infect with 1 µL of the 10-4 phage dilution. Incubate without shaking at 37 °C for 45 min. Repeat the same procedure for the 10-6 dilution.
    3. Plate dilutions of the infected bacteria into 100 mm 2xYT plate. Put the plate at 30 °C overnight.
    4. Plate 100 µL of uninfected DH5αF' on a 2xYT agar plate supplemented with 100 µg/mL ampicillin to check the absence of contamination in the preparation.
    5. The day after count the number of colonies and calculate the phage titer. Express titer as number of phages/mL. Expected titer is 1012-13 phages/mL.
  4. Phage selection
    1. Phage selection using as bait purified antibodies
      1. Saturate phages by diluting 200 µL of phage preparation into an equal volume of PBS-4% skimmed milk and incubate for 1 h at room temperature in slow rotation. This step allows blocking of phages for unspecific binding. Transfer 30 µL of protein-G coated magnetic beads to a 1.5 mL tube.
      2. Wash two times as follows: add 500 µL of PBS, incubate on a wheel in slow rotation for 2 min at room temperature, draw the beads to one side of the tube using a magnet and remove the supernatant.
      3. Incubate saturated phages with washed beads for 30 min at room temperature with slow rotation.
      4. Draw the beads to one side using a magnetic field. Collect the supernatant containing phages to be used for the selection step.
      5. Prepare magnetic beads while performing the previous step, by conjugating the purified antibodies. Wash 30 µL of protein-G coated magnetic beads as described above. Dilute 10 µg of purified antibodies in 500 µL of PBS, add to the washed beads and incubate in slow rotation at room temperature for 45 min. Wash twice with PBS.
        NOTE: Perform two different preparations of magnetic beads: one with antibodies of interest and one with control antibodies, e.g., antibodies purified from healthy donors. The sequence of antigens selected with control antibodies are subtracted during the analysis step of the outputs. Alternatively, magnetic beads loaded with control antibodies can be used to perform a pre-clearing step of the phages (follow the protocol for the incubation with un-conjugated beads).
      6. Phage selection: draw beads to one side of the tube using a magnet, remove the last wash, add phages and incubate with slow rotation at room temperature for 90 min. Wash 5 times with 500 µL of PBS-0.1% Tween-20 and 5 times with PBS.
      7. Elute bound phages, representing the output of the selection, by mixing the beads with 1 mL of DH5αF' cells grown at OD600 = 0.5. Incubate bacteria with beads for 45 min at 37 °C with occasional shaking (every 10 min). Plate the output on a 150 mm 2xYT agar plate supplemented with 100 µg/mL ampicillin.
      8. Plate 100 µL of undiluted and of different dilutions of the output (10-1 to 10-5) to perform titration. The day after collect bacteria from the 150 mm plates by adding 3 mL of fresh 2xYT medium and harvesting them with a sterile scraper, mix thoroughly, supplement them with 20% sterile glycerol and store at -80 °C in small aliquots.
      9. Grow one aliquot again to perform a second round of selection. Repeat all the panning procedure as described above except for the washing conditions. In this case wash 10 times with PBS-1% Tween-20 (pour solution in the tube and pour out again immediately). Then add 500 µL of PBS and incubate on rotation at room temperature for 10 min. Perform other 10 washes with PBS. Proceed with the elution step as for the first round of selection.
      10. Extract plasmid DNA from one aliquot of the output using a column-based kit, following manufacturers' instructions. Store plasmid at -20 °C until it will be used for deep sequencing.
    2. Phage selection using as bait recombinant proteins
      1. Saturate phages by diluting 200 µL of phage preparation into an equal volume of PBS-4% skimmed milk and incubate for 1 h at room temperature in slow rotation.
      2. Add 100 µL of streptavidin magnetic beads. Incubate for 1 h at room temperature to select streptavidin-binding phages. Remove the streptavidin-bound phages by drawing the beads to one side using a magnet. Take supernatant from the previous step and add biotinylated protein (in a concentration of 100-550 nM) and incubate on a rotor at room temperature for 30 min to 1 h.
      3. Prepare magnetic beads: while performing the previous step, wash 100 µL of streptavidin-magnetic beads with PBS, resuspend in PBS 2% skimmed milk and incubate with rotation at room temperature for 30 min to 1 h.
      4. Phage selection: Draw beads to one side of the tube using a magnet, remove PBS-2% milk and resuspend beads with phage-protein mix. Incubate with slow rotation at room temperature for 90 min.
      5. Draw beads to one side of the tube using a magnet, discard the supernatant and wash them carefully five times with 500 µL of PBS 0.1% Tween-20. Perform elution as described in the previous session.

4. Phage Library Deep Sequencing Platform (Figure 3)

  1. DNA inserts recovery from pFILTER-ORF-library, pDAN5-ORF-library or selected-phage-libraries
    1. Thaw one aliquot of the library, quantify it by using a spectrophotometer, recover DNA inserts by amplification with specific primers.
      NOTE: The primers used to rescue the inserts are linked at their 5' end to adaptors sequences, thus allowing the successive indexing of the amplicon pools obtained and the direct sequencing of the DNA inserts recovered by using the sequencers. Their sequence is in the Table of Materials. The adaptors are indicated in bold, and the specific primers are indicated in italics.
    2. Use 2.5 µL of the (pFILTER/phagemid/selected-phage) library as DNA template for a PCR reaction.
    3. Use the following program: 95 °C for 3 min; 25 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; 72 °C for 5 min. Hold at 4 °C.
      NOTE: At this point it is recommended to run 1 µL of the PCR product on a Bioanalyzer or TapeStation to verify the size of the amplicons and check that they are in the correct range.
  2. PCR clean-up
    1. Bring the magnetic beads (e.g., AMPure) to room temperature. Transfer the entire PCR product from the PCR tube to a 1.5 mL tube. Vortex the magnetic beads for 30 s to make sure that the beads are evenly dispersed. Add 20 µL of magnetic beads to each tube containing the PCR product, mix by gently pipetting. Incubate at room temperature without shaking for 5 min.
    2. Place the plate on a magnetic stand for 2 min or until the supernatant has cleared. With the PCR products on the magnetic stand, remove and discard the supernatant.
    3. Wash the beads with freshly prepared 80% ethanol, with the PCR products on the magnetic stand, as follows: add 200 µL of freshly prepared 80% ethanol to each sample well; incubate the plate on the magnetic stand for 3 s; carefully remove and discard the supernatant.
    4. Perform a second ethanol wash, with the PCR products on the magnetic stand; at the end of second wash carefully remove all the ethanol and allow the beads to air-dry for 10 min.
    5. Remove the PCR products from the magnetic stand, add 17.5 µL of 10 mM Tris pH 8.5 to each tube, gently pipette up and down 10 times, make sure that beads are fully resuspended. Incubate at room temperature for 2 min.
    6. Place the tube on the magnetic stand for 2 min or until the supernatant has cleared, carefully transfer 15 µL of the supernatant containing the purified PCR products to a new 1.5 mL tube. Store the purified PCR products at -15 ° C to -25 °C for up to a week if you do not immediately proceed to Index PCR.
  3. Index PCR
    NOTE: After PCR clean up, perform Index PCR. Use the Nextera XT Index kit; thus it will be possible to sequence the resulting double indexed libraries within multiplexed Illumina runs.
    1. Transfer all the 15 μL containing each product purified into a new PCR tube and set up the following reaction containing: 15 µL of purified amplicon product, 5 µL of Index Primer 1 and 5 µL of Index Primer 2, 25 µL of 2x PCR mix; final volume of 50 µL.
    2. Perform PCR on a thermal cycler using the following program: 95 °C for 3 min, 8 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; 72°C for 5 min, then hold at 4 °C.
  4. PCR clean-up 2
    1. Follow the same protocol described in the section 4.2 for PCR clean up with the following changes: in the first step add 56 µL of magnetic beads to each 50 µL of PCR product.
    2. Resuspend the beads in 27.5 µL of 10 mM Tris pH 8.5 in the final step of purification and transfer 25 µL to a new tube (this is the purified final library ready for quantification and then sequencing).
    3. Store the plate at -15 °C to -25 °C for up to a week if not proceeding to Library Quantification.
  5. Qualitative and quantitative evaluation of the sequencing library
    1. After purification, run 1 µL of a 1:10 dilution of the final library on a bioanalyzer to verify the size and quantify it selecting the region of the final library trace.
    2. In parallel perform the library quantification by Real Time PCR by using a library quantification kit per manufacturer's protocol.
  6. Libraries sequencing
    1. Pool the dual indexed libraries produced together with other dual indexed sequencing libraries. Sequence this kind of library by generating long reads, at least 250 bp paired end by using both the Hiseq2500 or the MiSeq instruments to obtain in the first case 250bp PE reads and in the second case 300 bp PE reads.

5. Bioinformatic Data Analysis by Using the Interactome-Seq Web Tool

  1. Analyze the reads originated from pFILTER/phagemid/selected-phage library sequencing with the Interactome-seq data analysis pipeline. The web tool is freely available at the following address: http://interactomeseq.ba.itb.cnr.it/

Access restricted. Please log in or start a trial to view this content.

Results

The filtering approach is schematized in Figure 1. Each kind of intronless DNA can be used. In Figure 1A the first part of the filtering approach is represented: after loading on an agarose gel or a bioanalyzer, a good fragmentation of the DNA of interest appears as a smear of fragments with a length distribution in the desired size of 150-750 bp. A representative virtual gel image of the fragmented DNA obtained is given. Fragmen...

Access restricted. Please log in or start a trial to view this content.

Discussion

The creation of a high quality highly diverse ORFs filtered library is the first critical step in the whole procedure since it will affect all the subsequent steps of the pipeline.

An important advantageous feature of our method is that any source of (intronless) DNA (cDNA, genomic DNA, PCR derived or synthetic DNA) is suitable for library construction. The first parameter that should be taken into account is that the length of the DNA fragments cloned into the pFILTER vector should provide a ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by a grant from the Italian Ministry of Education and University (2010P3S8BR_002 to CP).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Sonopuls ultrasonic homogenizerBandelinHD2070or equivalent
GeneRuler 100 bp Plus DNA LadderThermo ScientificSM0321or equivalent
GeneRuler 1 kb DNA LadderThermo Fisher ScientificSM0311or equivalent
Molecular Biology AgaroseBioRad161-3102or equivalent
Green Gel PlusFisher Molecular BiologyFS-GEL01or equivalent
6x DNA Loading DyeThermo Fisher ScientificR0611or equivalent
QIAquick Gel Extraction KitQiagen28704or equivalent
Quick Blunting KitNew England BiolabsE1201S
NanoDrop 2000 UV-Vis SpectrophotometerThermo Fisher ScientificND-2000
High-Capacity cDNA Reverse Transcription KitThermo Fisher Scientific4368813
Streptavidin Magnetic BeadsNew England BiolabsS1420Sor equivalent
QIAquick PCR purification KitQiagen28104or equivalent
EcoRVNew England BiolabsR0195L
Antarctic PhosphataseNew England BiolabsM0289S
T4 DNA LigaseNew England BiolabsM0202T
Sodium Acetate 3M pH5.2general lab supplier
Ethanol for molecular biologySigma-AldrichE7023or equivalent
DH5aF' bacteria cellsThermo Fisher Scientific
0,2 ml tubesgeneral lab supplier
1,5 ml tubesgeneral lab supplier
0,1 cm electroporation cuvettesBiosigma4905020
Electroporator 2510Eppendorf
2x YT mediumSigma-AldrichY1003
Ampicillin sodium saltSigma-AldrichA9518
ChloramphenicolSigma-AldrichC0378
DreamTaq DNA PolymeraseThermo Fisher ScientificEP0702
Deoxynucleotide (dNTP) Solution MixNew England BiolabsN0447S
96-well thermal cycler (with heated lid)general lab supplier
150 mm platesgeneral lab supplier
100 mm platesgeneral lab supplier
GlycerolSigma-AldrichG5516
BssHIINew England BiolabsR0199L
NheINew England BiolabsR0131L
QIAprep Spin Miniprep KitQiagen27104or equivalent
M13KO7 Helper PhageGE Healthcare Life Sciences27-1524-01 
Kanamycin sulfate from Streptomyces kanamyceticusSigma-AldrichK1377
Polyethylene glycol (PEG)Sigma-AldrichP5413
Sodium Cloride (NaCl)Sigma-AldrichS3014
PBSgeneral lab supplier
Dynabeads Protein G for ImmunoprecipitationThermo Fisher Scientific10003Dor equivalent
MagnaRack Magnetic Separation RackThermo Fisher ScientificCS15000or equivalent
Tween 20Sigma-AldrichP1379
Nonfat dried milk powderEuroCloneEMR180500
KAPA HiFi HotStart ReadyMix Kapa Biosystems, Fisher Scientific7958935001
AMPure XP beadsAgencourt, Beckman CoulterA63881
Nextera XT dual Index PrimersIlluminaFC-131-2001 or FC-131-2002 or FC-131-2003 or FC-131-2004
MiSeq or Hiseq2500Illumina
SpectrophotomerNanodrop
Agilent Bioanalyzer or TapeStationAgilent
Forward PCR primergeneral lab supplier5’ TACCTATTGCCTACGGCA
GCCGCTGGATTGTTATTACTC 3’
Reverse PCR primergeneral lab supplier5’ TGGTGATGGTGAGTACTA
TCCAGGCCCAGCAGTGGGTTTG 3’
Forward primer for NGSgeneral lab supplier5’ TCGTCGGCAGCGTCAGA
TGTGTATAAGAGACAGGCA
GCAAGCGGCGCGCATGC 3’;
Reverse primer for NGSgeneral lab supplier5’ GTCTCGTGGGCTCGGAGA
TGTGTATAAGAGACAGGGG
ATTGGTTTGCCGCTAGC 3’;

References

  1. Loman, N. J., Pallen, M. J. Twenty years of bacterial genome sequencing. Nat Rev Microbiol. 13 (12), 787-794 (2015).
  2. Jones, C. E., Brown, A. L., Baumann, U. Estimating the annotation error rate of curated GO database sequence annotations. BMC Bioinformatics. 8 (1), 170(2007).
  3. Andorf, C., Dobbs, D., Honavar, V. Exploring inconsistencies in genome-wide protein function annotations: a machine learning approach. BMC Bioinformatics. 8 (1), 284(2007).
  4. Wong, W. -C., Maurer-Stroh, S., Eisenhaber, F. More Than 1,001 Problems with Protein Domain Databases: Transmembrane Regions, Signal Peptides and the Issue of Sequence Homology. PLoS Comput Biol. 6 (7), e1000867(2010).
  5. Bioinformatics, B., et al. Identification and correction of abnormal, incomplete and mispredicted proteins in public databases. BMC Bioinformatics. 9 (9), (2008).
  6. Phizicky, E., Bastiaens, P. I. H., Zhu, H., Snyder, M., Fields, S. Protein analysis on a proteomic scale. Nature. 422 (6928), 208-215 (2003).
  7. DiDonato, M., Deacon, A. M., Klock, H. E., McMullan, D., Lesley, S. A. A scaleable and integrated crystallization pipeline applied to mining the Thermotoga maritima proteome. J Struct Funct Genomics. 5 (1-2), 133-146 (2004).
  8. Nordlund, P., et al. Protein production and purification. Nat Methods. 5 (2), 135-146 (2008).
  9. Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. Selecting open reading frames from DNA. Genome Res. 13 (5), 980-990 (2003).
  10. Di Niro, R., et al. Rapid interactome profiling by massive sequencing. Nucleic Acids Res. 38 (9), e110(2010).
  11. Gourlay, L. J., et al. Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063. Acta Crystallogr Sect D Biol Crystallogr. 71 (Pt 11), 2227-2235 (2015).
  12. D'Angelo, S., et al. Filtering "genic" open reading frames from genomic DNA samples for advanced annotation. BMC Genomics. 12 (Suppl 1), S5(2011).
  13. D'Angelo, S., et al. Profiling celiac disease antibody repertoire. Clin Immunol. 148 (1), 99-109 (2013).
  14. Robinson, M. D., McCarthy, D. J., Smyth, G. K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 26 (1), 139-140 (2009).
  15. Heger, A., Holm, L. Exhaustive enumeration of protein domain families. J Mol Biol. 328 (3), 749-767 (2003).
  16. Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. Selecting open reading frames from DNA. Genome Res. 13 (5), 980-990 (2003).
  17. Faix, P. H., Burg, M. A., Gonzales, M., Ravey, E. P., Baird, A., Larocca, D. Phage display of cDNA libraries: Enrichment of cDNA expression using open reading frame selection. Biotechniques. 36 (6), 1018-1029 (2004).
  18. Patrucco, L., et al. Identification of novel proteins binding the AU-rich element of α-prothymosin mRNA through the selection of open reading frames (RIDome). RNA Biol. 12 (12), 1289-1300 (2015).
  19. Collins, M. O., Choudhary, J. S. Mapping multiprotein complexes by affinity purification and mass spectrometry. Curr Opin Biotechnol. 19 (4), 324-330 (2008).
  20. Suter, B., Kittanakom, S., Stagljar, I. Two-hybrid technologies in proteomics research. Curr Opin Biotechnol. 19 (4), 316-323 (2008).
  21. Nakai, Y., Nomura, Y., Sato, T., Shiratsuchi, A., Nakanishi, Y. Isolation of a Drosophila gene coding for a protein containing a novel phosphatidylserine-binding motif. J Biochem. 137 (5), 593-599 (2005).
  22. Deng, S. J., et al. Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display. J Biol Chem. 269 (13), 9533-9538 (1994).
  23. Danner, S., Belasco, J. G. T7 phage display: A novel genetic selection system for cloning RNA-binding proteins from cDNA libraries. Proc Natl Acad Sci. 98 (23), 12954-12959 (2001).
  24. Gargir, A., Ofek, I., Meron-Sudai, S., Tanamy, M. G., Kabouridis, P. S., Nissim, A. Single chain antibodies specific for fatty acids derived from a semi-synthetic phage display library. Biochim Biophys Acta - Gen Subj. 1569 (1-3), 167-173 (2002).
  25. Patrucco, L., et al. Identification of novel proteins binding the AU-rich element of α-prothymosin mRNA through the selection of open reading frames (RIDome). RNA Biol. 12 (12), 1289-1300 (2015).
  26. Ausubel, F. M., et al. Current Protocols in Molecular Biology. Mol Biol. 1 (2), 146(2003).
  27. Sblattero, D., Bradbury, A. Exploiting recombination in single bacteria to make large phage antibody libraries. Nat Biotechnol. 18, 75-80 (2000).
  28. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 17 (1), 10(2011).
  29. Camacho, C., et al. BLAST+: architecture and applications. BMC Bioinformatics. 10 (1), 421(2009).
  30. Li, H., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25 (16), 2078-2079 (2009).
  31. Quinlan, A. R. BEDTools: The Swiss-Army tool for genome feature analysis. Curr Protoc Bioinforma. , (2014).
  32. Skinner, M. E., Uzilov, A. V., Stein, L. D., Mungall, C. J., Holmes, I. H. JBrowse: A next-generation genome browser. Genome Res. 19 (9), 1630-1638 (2009).
  33. Gourlay, L. J., et al. Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063. Acta Crystallogr Sect D Biol Crystallogr. 71, 2227-2235 (2015).
  34. D'Angelo, S., et al. Filtering "genic" open reading frames from genomic DNA samples for advanced annotation. BMC Genomics. 12 (Suppl 1), S5(2011).
  35. Di Niro, R., et al. Characterizing monoclonal antibody epitopes by filtered gene fragment phage display. Biochem J. 388 (Pt 3), 889-894 (2005).
  36. D'Angelo, S., et al. Profiling celiac disease antibody repertoire. Clin Immunol. 148 (1), 99-109 (2013).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

ORF Library ConstructionGel ElectrophoresisDNA LigationElectroporationAntibiotic SelectionPlasmid PurificationNGS Analysis