Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Summary

Various antisense oligonucleotides (AONs) have been shown to induce exon inclusion (splice modulation) and rescue SMN expression for spinal muscular atrophy (SMA). Here, we describe a protocol for AON lipotransfection to induce exon inclusion in the SMN2 gene and the evaluation methods to determine the efficacy in SMA patient fibroblasts.

Abstract

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide (AON)-mediated therapy. While SMN1 mutations are responsible for the disease, AONs targeting intronic splice silencer (ISS) sites in SMN2, including FDA-approved nusinersen, have been shown to restore SMN expression and ameliorate the symptoms. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries targeting SMN2 that may be more effective and less toxic than nusinersen. Here, we describe a protocol for in vitro evaluation of exon inclusion using lipotransfection of AONs followed by reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), and Western blotting. This method can be employed for various types of AON chemistries. Using this method, we demonstrate that AONs composed of alternating locked nucleic acids (LNAs) and DNA nucleotides (LNA/DNA mixmers) lead to efficient SMN2 exon inclusion and restoration of SMN protein at a very low concentration, and therefore, LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases. The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various novel AONs.

Introduction

Spinal muscular atrophy (SMA) is a fatal neuromuscular disorder inherited in an autosomal recessive pattern. It is characterized by the degradation of motor neurons and progressive trunk and limb muscle paralysis^1,2. The majority of SMA occurrences are due to a homozygous mutation in the survival of motor neuron 1 (SMN1) gene³. The survival of motor neuron 2 (SMN2) gene is an inverse duplicate of SMN1, and has a nearly identical sequence differing by only five bases^4,5. A C-to-T trans....

Protocol

1. Cell culture

1. Culture SMA patient fibroblasts in the growth medium (Dulbecco's modified Eagle medium 1:1 F-12 (Ham) with 10% fetal bovine serum (FBS) and 0.5% penicillin/streptomycin) in a CO₂ incubator at 37 °C.
2. Determine cell concentration using an automated cell counter and dilute cells to 1 x 10⁵ cells/mL in the growth medium, then seed on the appropriate plate. Use 12-well plates (1 mL per well) for RT-PCR or qPCR.
3. Incubate the plates for 24 h in a CO₂ incubator at 37 °C.

2. LNA/DNA mixmer transfection

1. Ensure cell confluency of arou....

Results

Using SMA patient fibroblasts, we targeted the ISS-N1 silencer region in intron 7 of the SMN2 gene with eight different antisense LNA/DNA mixmers that were transfected at a 5 nM concentration (Figure 3). Each of the mixmers contained a modified phosphorothioated backbone which enabled them to resist nuclease degradation. To evaluate the efficacy of the mixmers, the rate of SMN2 exon 7 inclusion was quantified by RT-PCR and qPCR using primers.......

Discussion

The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various AONs. This protocol is widely applicable to exon skipping and inclusion of other genes and various cell types. In addition, most AON chemistries (except PMOs) can be transfected using this method. AONs can regulate splicing of pre-mRNA from both endogenous and artificially introduced genes, and can be co-transfected with plasmid vectors carrying targeted genes.

A critical step .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
SMA Fibroblasts	Coriell NIGMS human genetic cell repository	GM03813
Dulbecco's Modified Eagle Medium (DMEM)	Thermo Fisher	11320033
Fetal Bovine Serum	Sigma-Aldrich	F1051
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher	15140122
Trypsin-EDTA (0.05%), phenol red	Thermo Fisher	25300062
Serum-deprived media	Thermo Fisher	31985070
Transfection reagent	Thermo Fisher	15338100
guanidinium thiocyanate-phenol-chloroform (TRIzol)	Thermo Fisher	15596-018
RT-PCR Primers			Sequence 5' to 3'
SMN2 forward:			CTGCCTCCATTTCCTTCTG
SMN2 reverse:			TGGTGTCATTTAGTGCTGCTC
GAPDH forward:			TCCCTGAGCTGAACGGGAAG
GAPDH reverse:			GGAGGAGTTTGGTCGCTGT
qPCR Primers
full-length SMN2 forward:			GCTATCATACTGGCTATTATATGGGTTTT
full-length SMN2 reverse:			CTCTATGCCAGCATTTCTCCTTAAT
GAPDH forward:			GCAAATTCCATGGCACCGT
GAPDH reverse:			AGGGATCTCGCTCCTGGAA
Chloroform	Sigma-Aldrich	P3803
Glycogen, RNA grade	Thermo Fisher	R0551
ImageJ Software
Protease cocktail inhibitor	Roche	11836153001
Cathode Buffer			0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer			0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer			0.3 M Tris base + 20% Methanol
Beta Mercaptoethanol	Millipore	ES-007-E
PVDF membrane	GE	10600021
Loading/sample buffer for Western blotting	NuPage Invitrogen	NP007
One-Step RT-PCR kit	Qiagen	210210
dNTPs	Clontech	3040