A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

14K views

⸱

DOI:

10.3791/57530

⸱

May 11th, 2018

In This Article

Summary

Various antisense oligonucleotides (AONs) have been shown to induce exon inclusion (splice modulation) and rescue SMN expression for spinal muscular atrophy (SMA). Here, we describe a protocol for AON lipotransfection to induce exon inclusion in the SMN2 gene and the evaluation methods to determine the efficacy in SMA patient fibroblasts.

Abstract

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide (AON)-mediated therapy. While SMN1 mutations are responsible for the disease, AONs targeting intronic splice silencer (ISS) sites in SMN2, including FDA-approved nusinersen, have been shown to restore SMN expression and ameliorate the symptoms. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries targeting SMN2 that may be more effective and less toxic than nusinersen. Here, we describe a protocol for in vitro evaluation of exon inclusion using lipotransfection of AONs followed by reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), and Western blotting. This method can be employed for various types of AON chemistries. Using this method, we demonstrate that AONs composed of alternating locked nucleic acids (LNAs) and DNA nucleotides (LNA/DNA mixmers) lead to efficient SMN2 exon inclusion and restoration of SMN protein at a very low concentration, and therefore, LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases. The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various novel AONs.

Introduction

Spinal muscular atrophy (SMA) is a fatal neuromuscular disorder inherited in an autosomal recessive pattern. It is characterized by the degradation of motor neurons and progressive trunk and limb muscle paralysis1,2. The majority of SMA occurrences are due to a homozygous mutation in the survival of motor neuron 1 (SMN1) gene3. The survival of motor neuron 2 (SMN2) gene is an inverse duplicate of SMN1, and has a nearly identical sequence differing by only five bases4,5. A C-to-T transition in SMN2 located in exon 7 makes the gene nearly nonfunctional because the mutation leads to the essential exon 7 being excluded in nearly 90% of SMN2 transcripts (Figure 1a). SMN2 mRNAs missing exon 7 cannot compensate for the SMN1 function because its protein product is unstable and is rapidly degraded.

Antisense therapy recently emerged as a very promising strategy for treating SMA6. The recent approval of nusinersen by the U.S. Food and Drug Administration (FDA) made it the first drug available for treating SMA7. Nusinersen is an 18-mer antisense oligonucleotide (AON) with a 2′-O-methoxyethyl modification (MOE) and a phosphorothioate backbone. The drug targets the intronic splicing silencer N1 (ISS-N1) located in intron 7 of the SMN2 gene. Binding of nusinersen to ISS-N1 promotes the recovery of functional full-length SMN protein expression from the endogenous SMN2 gene by inducing exon 7 inclusion (Figure 1a)8,9,10. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries that may be more effective and less toxic than nusinersen. It has been demonstrated that AONs with other chemistries also efficiently induce exon inclusion in SMN2 exon 7 both in vitro and in vivo11,12,13.

Locked nucleic acids (LNAs) are chemically modified RNA analogs containing a methylene bridge connecting the 4′-Carbon with the 2′-Oxygen within the furanose structure (Figure 1b)14,15. Compared to DNAs or RNAs, LNAs have an increased affinity for binding to complementary RNA sequences and have the added benefit of being highly resistant to endogenous nucleases. The LNA chemistry has been applied for use as probes for fluorescence in situ hybridization (FISH) and in qPCR16,17. Also, it is utilized to regulate gene expression both in vitro and in vivo. GapmeR AONs are a combination of single-stranded DNA molecules flanked by several LNAs at the 5′ and 3′ ends. They knock down gene expression by binding complementary to targeted mRNAs, causing them to be degraded by the activated RNase H18. LNA/DNA mixmers are AONs which are composed of DNA nucleotides integrated in between LNAs. Presented in this orientation they can bind miRNA to inhibit its function (LNA-antimiR)19. Some LNA-antimiRs have reached clinical development. For examples, miravirsen (AntimiR-122) is an LNA-antimiR that inhibits miR-122 to treat hepatitis C infection and several Phase II clinical trials are currently ongoing19,20. Recently, it has been demonstrated that LNA/DNA mixmers can also modulate RNA splicing21. It can bind a specific sequence of mRNA and induce exon skipping in dystrophin mRNA and exon inclusion in SMN2 mRNA in vitro13,22.

In this article, we outline a methodology for the induction of exon inclusion using AONs and the evaluation of efficacy at the RNA and protein levels. To exemplify this method, we used the LNA/DNA mixmers targeting ISS-N1 in intron 7 of SMN2. AONs transfected into SMA patient cells by lipotransfection induced exon 7 inclusion in the final SMN2 transcript and upregulation of SMN protein production. One of the advantages of using LNA/DNA mixmers to induce the exon inclusion is that the effective concentration for the transfection is significantly lower than other chemistries13. This method can be used for many other AONs except for phosphorodiamidate morpholino oligomers (PMOs), which, due to their neutral charge, need to enter cells through endocytosis induced by the Endo-Porter co-transfection reagent.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Cell culture

  1. Culture SMA patient fibroblasts in the growth medium (Dulbecco's modified Eagle medium 1:1 F-12 (Ham) with 10% fetal bovine serum (FBS) and 0.5% penicillin/streptomycin) in a CO2 incubator at 37 °C.
  2. Determine cell concentration using an automated cell counter and dilute cells to 1 x 105 cells/mL in the growth medium, then seed on the appropriate plate. Use 12-well plates (1 mL per well) for RT-PCR or qPCR.
  3. Incubate the plates for 24 h in a CO2 incubator at 37 °C.

2. LNA/DNA mixmer transfection

  1. Ensure cell confluency of around 65 - 80% for optimal transfection efficiency.
  2. Thaw 10 μM LNA/DNA mixmers slowly on ice.
  3. In a 1.5-mL tube, prepare a 20x mixmer solution by adding the mixmers to serum-deprived media so that the final volume reaches 50 μL.
  4. Mix the mixmer solution with 50 μL of serum-deprived media containing 3% transfection reagent (1:1 ratio).
  5. Incubate for 10 minutes at room temperature.
  6. Add 900 μL serum-deprived medium with 5% FBS to each tube.
  7. Aspirate the old media from the plate and replace with 1 mL LNA/DNA mixmer solution containing the transfection reagent.
  8. Incubate the cells for 24 - 48 h at 37 °C in a CO2 incubator.

3. RNA extraction

  1. Remove the medium and add 1 mL of guanidinium thiocyanate-phenol-chloroform reagent to the cells. Wash the bottom of the well several times with guanidinium thiocyanate-phenol-chloroform and collect it into 1.5-mL tubes.
  2. Vortex at high speed for 30 s and store at -80 °C for 1 h or overnight.
  3. Thaw the samples at room temperature and vortex well.
  4. Add 200 µL chloroform, shake vigorously for 15 s, and incubate at room temperature for 3 min.
  5. Centrifuge at 12,000 x g for 15 min at 4 °C.
  6. Collect the top clear aqueous phase into a new tube. Make sure to avoid collecting any of the white interphase that forms between the upper and lower phases.
  7. Add 500 µL isopropanol and 1 µL 8 µg/µL glycogen (RNA grade). Vortex for 10 s and incubate at room temperature for 10 min or at -20 °C overnight.
  8. Centrifuge at 12,000 x g for 10 min at 4 °C and remove all of the supernatant. A white pellet will form at the bottom of the tube.
  9. Add 1 mL cold 75% ethanol and centrifuge at 7,500 x g for 5 min at 4 °C.
  10. Remove all the ethanol and dry the pellet at room temperature until no ethanol is left in the tube.
  11. Dissolve the pellet in 30 µL DNase/RNase free water, and incubate for 10 min at 60 °C.
  12. Measure RNA concentration using a spectrophotometer (at 260 nm), and adjust RNA concentration to 50 ng/µL.

4. One step RT-PCR to measure the exon inclusion rate of SMN2

  1. Mix 12.5 µL of 2x RT-PCR reaction buffer, 1.0 µL of one-step RT-PCR enzyme mix, 0.5 µL of each primer (SMN2 forward: 5'-CTGCCTCCATTTCCTTCTG-3', SMN2 reverse: 5'-TGGTGTCATTTAGTGCTGCTC-3', GAPDH forward: 5'-TCCCTGAGCTGAACGGGAAG-3', GAPDH reverse: 5'-GGAGGAGTTTGGTCGCTGT-3', 2 µL of total RNA (50 ng/µL), and 8.5 µL of RNase/DNase-free distilled water.
  2. After cDNA is synthesized at 50 °C for 15 min, start the PCR reaction. Amplify the SMN2 exon 6-8 with 30 PCR cycles (94 °C for 15 s, 60 °C for 30 s, 68 °C for 25 s). Amplify the GAPDH with 20 PCR cycles (94 °C for 15 s, 60 °C for 30 s, 68 °C for 20 s).
  3. Add 5 μL 6x loading dye to the PCR product, and load 5 µL of the mixture into a 2% agarose gel and run for 40 min at 100 V.
  4. Image the gel and analyze it using ImageJ software.
  5. Measure the intensity of full-length bands and Δ7 bands. Calculate the rate of exon 7 inclusion by the intensity value of (full-length)/ (full-length + Δ7 SMN2).

5. Quantitative PCR (qPCR) to measure the exon inclusion rate of SMN2

  1. For cDNA synthesis, mix 1 µL Oligo dT, 1 µL 10 mM dNTPs, and 11 µL total RNA (50 ng/µL). Incubate at 65 °C for 5 min.
  2. Place the samples on ice and add 4 µL 5x buffer, 1 µL 0.1 M DTT, 1 µL RNase inhibitor, and 1 µL reverse transcriptase to each sample.
  3. Incubate at 50 °C for 60 min, and heat up to 80 °C for 10 min to stop the reaction. The cDNA can be stored at -20 °C.
  4. Dilute the cDNAs with RNase-free water (1:5 dilution). Mix 10 µL 2x SYBR Green qPCR enzyme mix, 0.8 µL 10 µM each primer (full-length SMN2 forward: 5′-GCTATCATACTGGCTATTATATGGGTTTT-3′, full-length SMN2 reverse: 5′-CTCTATGCCAGCATTTCTCCTTAAT-3′, Δ7 SMN2 forward: 5′-TCTGGACCACCAATAATTCCCC-3′, Δ7 SMN2 reverse: 5′-ATGCCAGCATTTCCATATAATAGCC-3′, GAPDH forward: 5′-GCAAATTCCATGGCACCGT-3′, GAPDH reverse: 5′-AGGGATCTCGCTCCTGGAA-3′), 3 µL diluted cDNA, and 5.4 µL RNase-free water.
  5. Start the qPCR reaction. Use the conditions: 95 °C for 30 s, then a 40 cycle repeat at 95 °C for 5 s and 60 °C for 20 s.
  6. Calculate the relative expression of full-length SMN2 to GAPDH or Δ7 SMN2, and normalize to the non-treated cells with the ΔΔCt algorithm.

6. Western blotting

  1. Remove transfection medium from cells and wash with phosphate-buffered saline (PBS) once.
  2. Add 100 µL lysis buffer with a protease inhibitor.
  3. Detach cells from the bottom of each well using a sterile cell scraper, and collect into 1.5-mL tubes. Incubate samples on ice for 30 min.
  4. Pass cell lysate through 21-G needle 10 times to crush the cells.
  5. Centrifuge at 20,800 x g for 15 min at 4 °C and collect the supernatant into new 1.5-mL tubes. The sample can be stored in a -80 °C deep freezer.
  6. Determine protein concentration using a BCA Protein Assay Kit, and adjust the concentration to 1.0 µg/µL.
  7. Mix 5 µL samples and 5 µL 2x sodium dodecyl sulfate (SDS) sample buffer (10% SDS; 14% 0.5M Tris-HCl solution, pH 6.7; 1% 0.5M EDTA-2Na stock solution, pH 8.0; 20% Glycerol; 0.004% bromophenol blue dye, 5% β-mercaptoethanol) and heat at 70 °C for 10 min.
  8. Load the samples into a 4-12% Bis-Tris Protein gels and run for 1 h at 150 V.
  9. Soak a thick filter paper in each buffer: (Concentrated anode buffer: 0.3 M Tris-HCl, 20% methanol; anode buffer: 0.03 M Tris-HCl, 20% methanol; cathode buffer: 25 mM Tris, 20% methanol, 40 mM 6- amino-n-hexanoic acid, 0.01% SDS).
  10. Soak a polyvinylidene difluoride (PVDF) membrane in methanol for 20 s, then transfer it into the anode buffer.
  11. Equilibrate the gel after SDS-PAGE with the cathode buffer for 5 - 10 min under agitation.
  12. Place the filter papers, PVDF membranes and the gel on a semi-dry blotting machine, as follows: concentrated anode buffer paper/anode buffer paper/PVDF membrane/protein gel/cathode buffer paper (Figure 2).
  13. Cover the stack and start the transfer at 20 V for 30 min.
  14. After the transfer, rinse the PVDF membrane with PBST (PBS with 0.05% Tween 20) once.
  15. Block the membrane at room temperature for 30 min in 5% skim milk powder dissolved in in PBST or at 4 °C for overnight.
  16. Dilute a purified mouse anti-SMN antibody and a rabbit anti-Cofilin antibody to 1:10,000 in 5% skim milk powder in PBST. Incubate the membrane in it for 1 h at room temperature or at 4 °C overnight.
  17. Wash 3 times with PBST for 10 min.
  18. Dilute secondary antibodies (HRP-conjugated goat anti-mouse and anti-rabbit IgG (H + L)) to 1:10,000 in 5% skim milk powder in PBST. Incubate for 1 h at room temperature in the dark.
  19. Wash the membrane 3 times with PBST for 10 min.
  20. Detect the band signal using the chemiluminescence Western blotting detection kit.

Access restricted. Please log in or start a trial to view this content.

Results

Using SMA patient fibroblasts, we targeted the ISS-N1 silencer region in intron 7 of the SMN2 gene with eight different antisense LNA/DNA mixmers that were transfected at a 5 nM concentration (Figure 3). Each of the mixmers contained a modified phosphorothioated backbone which enabled them to resist nuclease degradation. To evaluate the efficacy of the mixmers, the rate of SMN2 exon 7 inclusion was quantified by RT-PCR and qPCR using primers...

Access restricted. Please log in or start a trial to view this content.

Discussion

The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various AONs. This protocol is widely applicable to exon skipping and inclusion of other genes and various cell types. In addition, most AON chemistries (except PMOs) can be transfected using this method. AONs can regulate splicing of pre-mRNA from both endogenous and artificially introduced genes, and can be co-transfected with plasmid vectors carrying targeted genes.

A critical step ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors thank Nicole McRorie for help with the experiments. This work was supported by the University of Alberta Faculty of Medicine and Dentistry, Slipchuk SMA Research Foundation Research Grant, the Canadian Institutes of Health Research (CIHR), the Friends of Garrett Cumming Research Funds, HM Toupin Neurological Science Research Funds, the Muscular Dystrophy Canada, the Canada Foundation for Innovation, Alberta Enterprise and Advanced Education, and the Women and Children's Health Research Institute (WCHRI).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
SMA FibroblastsCoriell NIGMS human genetic cell repositoryGM03813
Dulbecco's Modified Eagle Medium (DMEM)Thermo Fisher11320033
Fetal Bovine SerumSigma-AldrichF1051
Penicillin-Streptomycin (10,000 U/mL)Thermo Fisher15140122
Trypsin-EDTA (0.05%), phenol redThermo Fisher25300062
Serum-deprived mediaThermo Fisher31985070
Transfection reagentThermo Fisher15338100
guanidinium thiocyanate-phenol-chloroform (TRIzol)Thermo Fisher15596-018
RT-PCR PrimersSequence 5' to 3'
SMN2 forward: CTGCCTCCATTTCCTTCTG
SMN2 reverse: TGGTGTCATTTAGTGCTGCTC
GAPDH forward: TCCCTGAGCTGAACGGGAAG
GAPDH reverse: GGAGGAGTTTGGTCGCTGT
qPCR Primers
full-length SMN2 forward:GCTATCATACTGGCTATTATATGGGTTTT
full-length SMN2 reverse: CTCTATGCCAGCATTTCTCCTTAAT
GAPDH forward: GCAAATTCCATGGCACCGT
GAPDH reverse:AGGGATCTCGCTCCTGGAA
ChloroformSigma-AldrichP3803
Glycogen, RNA gradeThermo FisherR0551
ImageJ Software
Protease cocktail inhibitor Roche11836153001
Cathode Buffer0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer0.3 M Tris base + 20% Methanol
Beta Mercaptoethanol MilliporeES-007-E
PVDF membrane GE10600021
Loading/sample buffer for Western blottingNuPage InvitrogenNP007
One-Step RT-PCR kit Qiagen 210210
dNTPsClontech3040

References

  1. Iascone, D. M., Henderson, C. E., Lee, J. C. Spinal muscular atrophy: from tissue specificity to therapeutic strategies. F1000Prime Rep. 7, 4(2015).
  2. Touznik, A., Lee, J. J., Yokota, T. New developments in exon skipping and splice modulation therapies for neuromuscular diseases. Expert Opin Biol Ther. 14 (6), 809-819 (2014).
  3. Lefebvre, S., et al. Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene. Cell. 80 (1), 155-165 (1995).
  4. Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).
  5. Monani, U. R., et al. A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet. 8 (7), 1177-1183 (1999).
  6. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3 (3), 144-176 (2013).
  7. Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Ther. 27 (2), 67-69 (2017).
  8. Hua, Y., et al. Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model. Nature. 478 (7367), 123-126 (2011).
  9. Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon. PLoS Biol. 5 (4), 73(2007).
  10. Passini, M. A., et al. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci Transl Med. 3 (72), (2011).
  11. Hammond, S. M., et al. Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy. Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).
  12. Porensky, P. N., et al. A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse. Hum Mol Genet. 21 (7), 1625-1638 (2012).
  13. Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts. Sci Rep. 7 (1), 3672(2017).
  14. Obika, S., et al. Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering. Tetrahedron Letters. 38 (50), 8735-8738 (1997).
  15. Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition. Chemical Communications. (4), 455-456 (1998).
  16. Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. Real-time PCR detection chemistry. Clin Chim Acta. 439, 231-250 (2015).
  17. Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. Small RNA Detection by in Situ Hybridization Methods. Int J Mol Sci. 16 (6), 13259-13286 (2015).
  18. Wahlestedt, C., et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).
  19. Rupaimoole, R., Slack, F. J. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 16 (3), 203-222 (2017).
  20. Lanford, R. E., et al. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science. 327 (5962), 198-201 (2010).
  21. Shimo, T., Maruyama, R., Yokota, T. Designing Effective Antisense Oligonucleotides for Exon Skipping. Methods Mol Biol. 1687, 143-155 (2018).
  22. Shimo, T., et al. Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro. Nucleic Acids Res. 42 (12), 8174-8187 (2014).
  23. Nguyen, Q., Yokota, T. Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy. J. Pers. Med. 7 (4), 13(2017).
  24. Echigoya, Y., et al. Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy. Mol Ther. , (2017).
  25. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5 (8), 12239(2010).
  26. Donnelly, E. M., et al. Characterization of a murine model of SMA. Neurobiol Dis. 45 (3), 992-998 (2012).
  27. Lim, K. R., Maruyama, R., Yokota, T. Eteplirsen in the treatment of Duchenne muscular dystrophy. Drug Des Devel Ther. 11, 533-545 (2017).
  28. Paton, D. M. Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy. Drugs Today (Barc). 53 (6), 327-337 (2017).
  29. Prakash, T. P., et al. Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides. J Med Chem. 51 (9), 2766-2776 (2008).
  30. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Exon Inclusion EvaluationSMN2 Exon 7Lipotransfection ProtocolRT-PCR AnalysisQuantitative PCRWestern BlottingLNA/DNA MixmersAntisense Oligonucleotide Therapy