A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

7.9K views

DOI:

10.3791/57560

August 2nd, 2018

In This Article

Summary

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

Abstract

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

Introduction

The clustered, regularly interspaced, short palindromic repeat (CRISPR) technology represents the most recent advancement in genome engineering and has revolutionized the current practice of genetics in cells and organisms. CRISPR-based genome editing utilizes a single guide RNA (gRNA) to direct a CRISPR-associated endonuclease such as CRISPR-associated protein 9 (Cas9) and Cpf1 to a genomic DNA target that is complementary in sequence to the protospacer encoded by the gRNA with a specific protospacer adjacent motif (PAM)1,2. The PAM varies depending on the bacterial species of the Cas9 or Cpf1 gene. The most commonly used Cas9 nuclease derived from Streptococcus pyogenes (SpCas9) recognizes a PAM sequence of NGG that is found directly downstream of the target sequence in the genomic DNA, on the non-target strand. At the target site, the Cas9 and Cpf1 proteins generate a double-strand break (DSB), which is then repaired via intrinsic cellular DNA repair mechanisms including non-homologous end joining (NHEJ) and homology-directed repair (HDR) pathways3,4. In the absence of a DNA template for homologous recombination, the DSB is primarily repaired by the error-prone NHEJ pathway, which can result in insertions or deletions (indels) of nucleotides causing frameshift mutations if the DSB were created in the coding region of a gene5,6. Thus, the CRISPR system has been widely used to engineer loss-of-function mutations in various cellular models and whole organisms, in order to investigate the function of a gene. Moreover, the catalytically inactive Cas9 and Cpf1 have been developed to transcriptionally and epigenetically modulate the expression of target genes7,8.

More recently, both SpCas9 and SaCas9 (derived from Staphylococcus aureus) have been packaged into recombinant adeno-associated virus (rAAV) vectors for postnatal gene correction in the animal model of human diseases, particularly, Duchenne muscular dystrophy (DMD)9,10,11,12,13,14,15. DMD is a fatal X-linked recessive disease caused by mutations in the DMD gene, which encodes dystrophin protein16,17, affecting approximately one in 3500 male births according to newborn screening18,19. It is characterized by progressive muscle weakness and wasting. The DMD patients usually lose the ability to walk between 10 and 12 years of age and die of respiratory and/or cardiac failure by the age of 20-30 years20. Notably, cardiomyopathy develops in >90% of DMD patients and represents the leading cause of death in DMD patients21,22. Although Deflazacort (an anti-inflammation drug) and Eteplirsen (an exon skipping medicine for skipping exon 51) have recently been approved for DMD by Food and Drug Administration (FDA)23,24, none of these treatments correct the genetic defect at the genomic DNA level. The mdx mouse, which carries a point mutation at exon 23 of the dystrophin gene, has been widely used as a DMD model25. Furthermore, we previously demonstrated that the functional dystrophin expression was restored by in-frame deletion of the genomic DNA covering exons 21, 22 and 23 in skeletal muscles of mdx mice using intramuscular Ad-SpCas9/gRNA delivery9, and in the heart muscles of mdx/utrophin+/- mice using intravenous and intraperitoneal rAAVrh.74-SaCas9/gRNA delivery26.

In this protocol, we describe in detail every step in postnatal cardiac gene editing to restore dystrophin in mdx/utrophin+/- mice using rAAVrh.74-SaCas9/gRNA vectors, from gRNA design to dystrophin analysis in the heart muscle sections.

Access restricted. Please log in or start a trial to view this content.

Protocol

The animals used in this protocol were maintained at The Ohio State University Laboratory Animal Resources in accordance with animal use guidelines. All animal studies were authorized by the Institutional Animal Care, Use, and Review Committee of the Ohio State University.

1. Design and Cloning of gRNAs into the CRISPR Vector

  1. Select 2 gRNAs targeting dystrophin intron 20 and intron 23 (i20 and i23) for SaCas9: i20: 5'-GGGCGTTGAAATTCTCATTAC CAGAGT and i23: 5'-CACCGATGAGAGGGAAAGGTC CTGAAT (the PAM sequence is underlined and italicized).
    NOTE: The target sites for i20 and i23 are about 23 kilo base pair (kbp) away. To disrupt a coding gene, two gRNAs targeting the common exons with the NNGRRT PAM sequence for SaCas9 (preferably NNGAAT, NNGGGT and NNGAGT) and distance within 20 kbp are recommended.
  2. Use the following PCR parameters to anneal the gRNA oligos (100 µmol/L) in 1x annealing buffer (the 5x annealing buffer stock contains 0.5 mol/L K-acetate, 150 mmol/L HEPES-KOH, 10 mmol/L Mg-acetate, pH7.4): 95 °C 10 min, 90 cycles of 95 to 59 °C with a 0.4 °C decrease per cycle for 20 s, 90 cycles of 59 to 32 °C with a 0.3 °C decrease per cycle for 20 s, 20 cycles of 32 to 26 °C with a 0.3 °C decrease per cycle for 20 s.
  3. Ligate the annealed gRNA oligos into the pX601-CMV-SaCas9-mPA-U6-gRNA using BsaI and T4 DNA ligase in one reaction (1 µL 50 ng/µL pX601-CMV-SaCas9-mPA-U6-gRNA, 1 µL annealed oligos, 1.5 µL 10x T4 DNA ligase buffer, 0.5 µL T4 DNA ligase, 1 µL BsaI, 10 µL ddH2O), with the following reaction condition in a PCR cycler: 5 cycles of [37 °C 5 min and 16 °C 10 min]; 37 °C 20 min; 80 °C 5 min.
  4. Transform the 15 µL ligation product into 30 µL competent cells, plate the cells in agar plate with 100 µg/mL Ampicillin, and culture at 37 °C for 24 h.
  5. Pick up 5-10 colonies and culture in LB medium containing 100 µg/mL Ampicillin at 37 °C, 250 rpm in a shaker incubator for 3-4 h.
  6. Screen the colonies by PCR: 10 µL 2x PCR master mix, 8 µL ddH2O, 1 µL E. Coli culture, 1 µL 10 µmol/L U6-forward primer, 1 µL i20 or i23 gRNA reverse primer. The PCR cycling parameters: 95 °C 5 min, 35 cycles of 95 °C 30 s, 61 °C 30 s, 72 °C 30 s.
  7. Prepare 5 mL culture of the positive clones by adding 4 mL fresh LB medium containing100 µg/mL Ampicillin, and culture overnight at 37 °C, 250 rpm.
  8. Purify the plasmid DNA using the appropriate plasmid extraction kit, and verify the plasmid by Sanger sequencing with the U6-forward primer.
  9. Culture C2C12 cells in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~70% confluency for testing the gene editing efficacy of the plasmids.
  10. Electroporate a total of 5 µg SaCas9/gRNA plasmid mixture in 1:1 molar ratio into 1 x 106 C2C12 cells according to the manufacturer's protocol.
  11. After 48 h post-transfection, harvest the C2C12 cells and extract genomic DNA.
  12. Use 100 ng genomic DNA as template to perform the PCR reaction for mouse dystrophin locus: forward primer 5'-GGCCAAAGCAAACTCTGGTA (1 µL 10 µmol/L), reverse primer 5'-TTTAATCCCACGTCATGCAA (1 µL 10 µmol/L), 10 µL 2x the green PCR master mix, 7 µL ddH2O, 1 µL genomic DNA (100 ng). Use PCR cycling conditions as 95 °C 5 min, 35 cycles of [95 °C 30 s, 61 °C 30 s, 72 °C 30 s], 72 °C 2 min.

2. rAAV Production

  1. To culture the cells, seed AD293 cells onto 20 to 40 of 15-cm dishes and maintain in DMEM supplemented with 10% FBS and 1% Pen-Strep until reaching ~90% confluency for transfection.
  2. Dilute 3 plasmids with 200 µL reduced serum medium (per dish): 1)10 µg pHelper; 2) 5 µg pXR(rh.74 or other serotypes) and 3) A total of 5 µg of pX601-i20 and pX601-i23 mixture (1:1 ratio). Perform polyethylenimine (PEI) transfection by mixing with 80 µL PEI and incubate at room temperature for 10 min. Add the mixture on to the AD293 cell cultures in a dropwise manner.
  3. For AAV virus production, after 72 h post transfection, use a cell scraper to collect both the media and the AD293 cell pellets by centrifugation at 1100 x g for 10 mins.
  4. Resuspend the cell pellets in 15 mL rAAV lysis buffer (50 mmol/L Tris Base, 150 mmol/L NaCl, pH 8.5) followed by 3 freeze-thaw cycles with alternating incubation in liquid nitrogen and a 42 °C water bath. Store the cell lysates in -80 °C for future processing if they are not being processed immediately.
  5. Filter the culture media with a 0.45-µm filter and add a 40% PEG8000 in 2.5 mol/L NaCl to a final concentration of 8%. Incubate the mixture at 4 °C for 1 h and centrifuge at 1100 x g for 15 min.
  6. Resuspend the pellets in rAAV lysis buffer and combine with the cell lysates from step 2.3, followed by benzonase (50 U/mL) treatment at 37 °C for 1 h.
  7. Centrifuge the benzonase-treated rAAV containing mixture 1100 x g for 15 min at 4 °C, and save the supernatant (the crude rAAV preparation).

3. rAAV Purification and Concentration

  1. Load the crude rAAV preparation onto an iodixanol gradient in an ultracentrifuge tube in the following order from the top to the bottom: crude AAV lysate (~15 mL), 8 mL 15% Iodixanol, 6 mL 25% Iodixanol, 5 mL 40% Iodixanol, 5 mL 58% Iodixanol. Fill the remaining empty volume of the tube to the top using 1x DPBS.
  2. Centrifuge the samples at 230,000 x g in an ultracentrifuge rotor for 120 min at 10 °C and collect 3 - 4 mL of the 40% gradient fraction containing the rAAV particles with an 18 G needle.
  3. Dilute the rAAV particles with 1x DPBS and centrifuge using the centrifugal filter unit (MWCO 100 kDa). Repeat this step for 3-5 times and finally concentrate the rAAV preparation to 300-500 µL.

4. rAAV Titering

  1. Extract the genomic DNA from 2 µL concentrated rAAV, precipitate with 3 M NaOAc in ethanol, and resuspend in 20 µL ddH2O.
  2. Obtain the standard curve for rAAV quantitation by serial dilution of the pX601 plasmid: 1 x 109, 1 x 108, 1 x 107, 1 x 106, 1 x 105 copies in each 10 µL ddH2O. Dilute the DNAase-treated rAAV samples as 1:10, 1:50, 1:100, and 1:1000.
  3. Determine rAAV titer by quantitative real-time PCR (qPCR) using qPCR Kit according to manufacturer's instruction in a Real-Time PCR system: 1 µL 10 µmol/L of each primer (5'-GGATTTCCAAGTCTCCACCC and 5'-TCCCACCGT ACACGCCTAC), 5 µL 2x PCR master mix, 1 µL diluted rAAV samples and 2 µL ddH2O. Run the reaction with the following cycling parameters: 95 °C 3 min, 45 cycles of [95 °C 5 sec and 61 °C 20 sec].

5. Intravenous and Intraperitoneal Injection of rAAVrh.74-CRISPR into Neonatal mdx/utrophin+/- Mice

  1. Immobilize the mdx/utrophin+/- mouse pups (day 3) by placing on ice for 1 min, and then administer with 1 x 1012 viral particles in 50 µL per mouse systemically via a retro-orbital approach or an intraperitoneal injection.
  2. Allow the mice to recover and place back into their home cages. At ten weeks after rAAV administration, euthanize the mice by CO2 exposure for tissue collection.
  3. Snap-freeze tissues for genomic DNA and RNA extraction, and use cooling isopentane in liquid nitrogen to freeze tissues with optimal cutting temperature compound for cryosectioning.

6. Analysis of Target Gene Editing Outcomes

  1. Genomic DNA PCR analysis
    1. Isolate the total genomic DNA from the heart tissues of mdx/utrophin+/- mice treated with or without rAAV.
    2. Use the same protocol in Step 1.12 for PCR analysis.
  2. RT-PCR analysis of dystrophin expression
    1. Extract total RNA from the heart tissues with the RNA extraction kit following the manufacturer's manual.
    2. To perform reverse transcription, pre-treat the total RNA with an RNase-free DNase and use 5 µg of treated RNA as the template for first-strand cDNA synthesis with the reverse transcription kit.
    3. Use the reverse transcription product for RT-PCR analysis of dystrophin expression with the dystrophin cDNA primers: 5'-GGCTAGAGTATCAAACCAACATCAT and 5'- TGGAGGCTTACGGTTTTATCC.
  3. Estimate the gene editing efficacy by qPCR analysis
    1. Estimate the gene editing efficacy by quantitative RT-PCR to detect the reduction of exon 22-containing transcripts using the forward primer (exon 21): 5'-TTGTCAGCTCTTCAGCCTCAAA, and the reverse primer (exon 23): 5'-AAACTCTCCTTCACAGTGTCACT. Use Gapdh as a reference gene with the forward primer: 5'- AGGTTGTCTCCTGCGACTTC and the reverse primer: 5'- GGTGGTCCAGGGTTTCTTACT.
    2. Run the quantitative real-time PCR (qPCR) using the qPCR Kit according to manufacturer's instruction in a Real-Time PCR system and the 2-step reaction conditions: 95 °C 3 min, 45 cycles of 95 °C 5 sec and 61 °C 30 sec.
  4. Immunofluorescence staining to analyze dystrophin expression
    1. Cut the frozen tissues using a cryostat at a thickness of 10 µm. Fix the frozen sections with 4% paraformaldehyde at room temperature for 15 min.
    2. Wash 2x with PBS and incubate with blocking solution (10% horse serum) for 1 h.
    3. Incubate the anti-dystrophin primary antibody, at 4 °C overnight.
    4. Wash the slides with PBS 3 x 5 min and incubate with fluorescent secondary antibodies (1:500) at room temperature for 1 h.
    5. Mount the slides using the mounting medium with DAPI and imaging with an inverted confocal microscope.

7. Off-target analysis by T7E1 assay

  1. Predict the potential off-target sites using the online CRISPR design tools such as <http://crispr.mit.edu>.
  2. Amplify the genomic regions covering the top 5-10 potential off-target sites by PCR: genomic DNA 200 ng, 1 µL high-fidelity DNA polymerase, 5 µL 10x PCR Buffer mix, 1.5 µL 10 µmol/L of site-specific forward and reverse primers, adjusting the total volume to 50 µL with ddH2O.
  3. Run the PCR products by electrophoresis, extract and purify the DNA using a gel extraction kit. Measure the concentration using spectrophotometers.
  4. Promote heteroduplex formation by denaturing and re-annealing the purified amplicons slowly in the Buffer 2.1 using a PCR cycler. Use the same cycling conditions as detailed in step 1.2.
  5. Digest the re-annealed products for 30 min at 37 °C with 0.5 µL T7E1 enzyme, and analyze the reaction by electrophoresis using 1-2% agarose gel.
    NOTE: The amplicons can also be analyzed by targeted deep sequencing.

Access restricted. Please log in or start a trial to view this content.

Results

The efficacy of the gRNAs to induce the deletion of the target genomic DNA region should be evaluated in cell cultures before packaging into rAAV for in vivo studies. To this end, the gRNAs and SaCas9-expressing constructs were electroporated into C2C12 cells and the genomic DNA was analyzed by PCR with the primers flanking the target sites (Figure 1). A PCR product of ~500 bp indicates successful deletion of the target genomic DNA resulting from gene editing...

Access restricted. Please log in or start a trial to view this content.

Discussion

In this protocol, we detail all the steps necessary to achieve in vivo cardiac gene editing in postnatal mice using rAAVrh.74-mediated delivery of SaCas9 and two gRNAs. As previously noted, this approach can be used to restore dystrophin expression in dystrophic mice as described in our work27, but it could also enable rapid reverse genetics studies of cardiac-related genes in mice without the lengthy process of the traditional knockout approach to generate and breed knockout mouse models...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflict of interest exists.

Acknowledgements

R.H. is supported by US National Institutes of Health grants (R01HL116546 and R01 AR064241).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Alexa Fluor 555 goat anti-rabbit IgGThermo Fisher ScientificA-21428
Benzonase NucleaseSigma-AldrichE1014
Bio Safety CabinetsThermo Fisher Scientific13471300 Series A2 Class II, Type A2
BsaINew England BioLabs IncRO535S
Competent cellsAgilent Technologies200314
Cell culture dishes, 150mmNest Scientific USA715001
CryostatLeica BiosystemsLeica CM3050S
DMEMThermo Fisher ScientificMT10017CVCorning cellgro
Dystrophin antibodySpring BioscienceE2660
Fast-Ion Midi Plasmdi KitsIBI ScientificIB47111
FBSThermo Fisher Scientific26-140-079
Filter Unit, 0.45μmThermo Fisher Scientific166-0045
GoTaq Master MixesPromegaM7122
High-speed plasmid mini kitIBI ScientificIB47102
Horse serumAbcamab139501
Isotemp 2239 Water BathThermo Fisher Scientific15-460-11Q
Isotemp Heat BlockThermo Fisher Scientific11-718
Inverted confocal microscopeCarl Zeiss Microscopy, LLCLSM 780
LightCycler 480 instrumentRoche5015243001LightCycler 480 Instrument II
Large Capacity CentrifugeThermo Fisher Scientific46-910Thermo Scientific Sorvall RC 6 Plus
MicrocentrifugeThermo Fisher Scientific75002445Sorvall Legend Micro 21R
Nanodrop spectrophotometersThermo ScientificND2000CLAPTOPNanoDrop™ 2000/2000c
Oligos for i20-FIntegrated DNA TechnologiesCACCgGGCGT
TGAAATTCTCATTAC
Oligos for i20-RIntegrated DNA TechnologiesAAAC GTAATGAGAATTTCAACGCCc;
Oligos for i23-FIntegrated DNA TechnologiesCACCgCACCGATGAGAGGG
AAAGGTC
Oligos for i23-RIntegrated DNA TechnologiesGACCTTTCCCTCTCATCGGTGc
OligosIntegrated DNA Technologies
OptiPrep Density Gradient MediumSigma-AldrichD1556-250ML
OptiMEMThermo Fisher Scientific31985070
PEG8000Sigma-Aldrich89510-1kg-F
PolyethyleniminePolysciences23966
Proteinase KSigma-AldrichP2308
Quick-Seal centrifuge tubeBeckman Coulter Inc342414
QIAquick Gel Extraction kitQiagen28704
Radiant SYBR Green Hi-ROX qPCR KitsAlkali ScientificQS2005
RevertAid RT Reverse Transcription KitThermo Fisher ScientificK1691
RotorBeckman Coulter Inc337922Type 70Ti
T4 DNA ligaseNew England BioLabs IncM0202S
Thermal CyclerBio-rad1861096
TRIzol ReagentThermo Fisher Scientific15596026
UltracentrifugeBeckman Coulter Inc8043-30-1192Optima le-80k
Ultra centrifugal filter unitMilliporeSigmaUFC510096
VECTASHIELD Mounting Medium with DAPIVector Laboratories, IncH-1200

References

  1. Makarova, K. S., Koonin, E. V. Annotation and Classification of CRISPR-Cas Systems. Methods Mol Biol. 1311, 47-75 (2015).
  2. Zetsche, B., et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 163, 759-771 (2015).
  3. Cong, L., et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 339, 819-823 (2013).
  4. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, 823-826 (2013).
  5. Lieber, M. R. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annual review of biochemistry. 79, 181-211 (2010).
  6. Ran, F. A., et al. Genome engineering using the CRISPR-Cas9 system. Nature protocols. 8, 2281-2308 (2013).
  7. Zhang, X., Wang, J., Cheng, Q., Zheng, X., Zhao, G. Multiplex gene regulation by CRISPR-ddCpf1. Cell discovery. 3, 17018(2017).
  8. Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. Off-target Effects in CRISPR/Cas9-mediated Genome Engineering. Molecular therapy. Nucleic acids. 4, e264(2015).
  9. Xu, L., et al. CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice. Mol Ther. 24, 564-569 (2015).
  10. Long, C., et al. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science. 351, 400-403 (2016).
  11. Long, C. Z., et al. Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science. 345, 1184-1188 (2014).
  12. Nelson, C. E., et al. In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science. 351, 403-407 (2016).
  13. Ousterout, D. G. K., Thakore, A. M., Majoros, P. I., Reddy, T. E. W. H., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun. 6, 6244(2015).
  14. Tabebordbar, M., et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 351, 407-411 (2016).
  15. Bengtsson, N. E., et al. Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy. Nat Commun. 8, 14454(2017).
  16. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, 919-928 (1987).
  17. Nowak, K. J., Davies, K. E. Duchenne muscular dystrophy and dystrophin: pathogenesis and opportunities for treatment. EMBO reports. 5, 872-876 (2004).
  18. Mendell, J. R., et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Annals of neurology. 71, 304-313 (2012).
  19. Mendell, J. R., Lloyd-Puryear, M. Report of MDA muscle disease symposium on newborn screening for Duchenne muscular dystrophy. Muscle Nerve. 48, 21-26 (2013).
  20. Spurney, C. F. Cardiomyopathy of Duchenne muscular dystrophy: current understanding and future directions. Muscle Nerve. 44, 8-19 (2011).
  21. Moriuchi, T., Kagawa, N., Mukoyama, M., Hizawa, K. Autopsy analyses of the muscular dystrophies. Tokushima J Exp Med. 40, 83-93 (1993).
  22. McNally, E. M. New approaches in the therapy of cardiomyopathy in muscular dystrophy. Annual review of medicine. 58, 75-88 (2007).
  23. Baker, D. E. Approvals, Submission, and Important Labeling Changes for US Marketed Pharmaceuticals. Hosp Pharm. 52, 306-307 (2013).
  24. Baker, D. E. Eteplirsen. Hosp Pharm. 52, 302-305 (2017).
  25. Sicinski, P., et al. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science. 244, 1578-1580 (1989).
  26. Xu, L., et al. CRISPR-mediated Genome Editing Restores Dystrophin Expression and Function in mdx Mice. Molecular therapy : the journal of the American Society of Gene Therapy. 24, 564-569 (2016).
  27. El Refaey, M., et al. In Vivo Genome Editing Restores Dystrophin Expression and Cardiac Function in Dystrophic Mice. Circ Res. 121, 923-929 (2017).
  28. Tabebordbar, M., et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 351, 407-411 (2016).
  29. Pozsgai, E. R., Griffin, D. A., Heller, K. N., Mendell, J. R., Rodino-Klapac, L. R. beta-Sarcoglycan gene transfer decreases fibrosis and restores force in LGMD2E mice. Gene therapy. 23, 57-66 (2016).
  30. Chicoine, L. G., et al. Plasmapheresis eliminates the negative impact of AAV antibodies on microdystrophin gene expression following vascular delivery. Mol Ther. 22, 338-347 (2014).
  31. Chicoine, L. G., et al. Vascular delivery of rAAVrh74.MCK.GALGT2 to the gastrocnemius muscle of the rhesus macaque stimulates the expression of dystrophin and laminin alpha2 surrogates. Mol Ther. 22, 713-724 (2014).
  32. Vouillot, L., Thelie, A., Pollet, N. Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases. G3. 5, 407-415 (2015).
  33. Tsai, S. Q., et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol. 33, 187-197 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

CRISPR Gene EditingDystrophin RestorationrAAVrh.74 DeliveryGuide RNA DesignPlasmid PurificationImmunofluorescence StainingGenomic DNA ExtractionConfocal Microscopy