A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

9.4K views

⸱

DOI:

10.3791/57609

⸱

October 7th, 2018

In This Article

Summary

Here, we present a protocol to promote transgene integration and production of founder transgenic mice with high efficacy by a simple injection of a lentiviral vector in the perivitelline space of a fertilized oocyte.

Abstract

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a routine procedure is widely utilized throughout the world and its main limitation resides in the poor efficacy of transgene integration, resulting in a low yield of founder animals. Only few percent of animals born after implantation of injected fertilized oocytes have integrated the transgene. In contrast, lentiviral vectors are powerful tools for integrative gene transfer and their use to transduce fertilized oocytes allows highly efficient production of founder transgenic mice with an average yield above 70%. Furthermore, any mouse strain can be used to produce transgenic animal and the penetrance of transgene expression is extremely high, above 80% with lentiviral mediated transgenesis compared to DNA microinjection. The size of the DNA fragment that can be cargo by the lentiviral vector is restricted to 10 kb and represents the major limitation of this method. Using a simple and easy to perform injection procedure beneath the zona pellucida of fertilized oocytes, more than 50 founder animals can be produced in a single session of microinjection. Such a method is highly adapted to perform, directly in founder animals, rapid gain and loss of function studies or to screen genomic DNA regions for their ability to control and regulate gene expression in vivo.

Introduction

The pioneering work of Gordon et al. in 1980 showed that after implantation in pseudopregnant mice, the plasmid DNA injection into the male pronuclei of fertilized oocytes can yield the production of transgenic animals that integrated the plasmid DNA1. The demonstration that transgenic mammals can be generated had an enormous impact on global life sciences, opening the way to novel fields of research both for basic sciences and translational biomedical sciences. In the past four decades, DNA microinjection has become a routine practice. Although an enormous number of transgenic mice have been produced, the standard method is not fully usable for all mouse strains and requires time consuming backcrosses2,3. Its application to other species remains challenging4 and the overall transgene integration yield is limited to a few percentage of born animals5. In addition, the efficacy of transgene integration represents the limiting factor that explains the poor overall yield of pronuclear DNA injection. In this respect, integrative viral vectors are the most efficient tools to cargo and integrate transgenes and thus could provide new means to significantly increase integration yield, the only limitation being that the transgene size that cannot exceed 10 kb6.

Lentiviral vectors pseudo-typed with the envelop protein of the Vesicular Stomatitis Virus (VSV) are pantropic and highly integrative gene transfer tools and can be used to transduce fertilized oocytes7. The zona pellucida surrounding the oocytes is a natural virus barrier and needs to be passed to allow transduction with the lentiviral vectors. Transgenic animals have been generated by transducing fertilized oocytes after micro-drilling or removing of the zona pellucida8,9. However, injection beneath the zona pellucida in the perivitelline space appears to be the simplest method to transduce the fertilized eggs as initially described by Lois and colleagues7.

The perivitelline injection of lentiviral vectors allows high yields in the production of transgenic animals that are above 70% of born animals. Such yield is over 10-fold higher than the best yield that can be achieved using standard pronuclei DNA injection7,10,11. In this context, a single session of injections will generate at least 50 transgenic founders (F0). The large number of founders is, therefore, compatible with phenotyping of the transgene effect directly performed on F0 mice without the need to generate transgenic mouse lines. This advantage allows for rapid screening of the transgene effect and is specifically adapted to perform in vivo gain and loss of function studies within weeks. In addition, regulatory DNA elements can also be rapidly screened to map enhancers and DNA motifs bound by transcription factors11,12. With pronuclear injections, transgenes usually integrate as multiple copies in a unique locus. With lentiviral vectors, integration occurs in multiple loci as a single copy per locus10,13. Therefore, the multiplicity of integrated loci is most likely associated to the very high expression penetrance observed in the transgenic founders, which makes the new generated model more robust.

Importantly, when using pronuclear injection of DNA, visualization of pronuclei during the procedure is absolutely required. This technical limitation prevents the usage of fertilized oocytes originating from a large variety of mouse strains. Therefore, production of a transgenic model in a specific strain for which pronuclei are invisible requires the production of animals in a permissive strain followed by at least 10 successive backcrosses to transfer the transgene in the desired mouse strain. With the lentiviral vector injections, perivitelline space is always visible and the injection does not require highly specific skills. As an example, NOD/SCID transgenic mice that are not appropriate for pronuclei injection have been obtained with the viral vector injections14.

Here, a comprehensive protocol is presented to allow simple production of transgenic mice using lentiviral vector injections in the perivitelline space of a one cell stage embryo. Transgene expression controlled with either ubiquitous or cell specific promoters is described in detail.

The pTrip ΔU3 lentiviral backbone was used in this study15. This vector allows for producing replication defective lentiviral vectors in which the U3 sequence has been partially deleted to remove U3 promoter activity and generate a self-inactivating vector (SIN)16. Lentiviral vector stocks were produced by transient transfection of HEK-293T cells with the p8.91 encapsulation plasmid (ΔVpr ΔVif ΔVpu ΔNef)6, the pHCMV-G encoding the vesicular stomatitis virus (VSV) glycoprotein-G17, and the pTRIP ΔU3 recombinant vector. The detailed production procedure is provided as supplemental methods.

Production of high titer lentiviral vector stocks is performed under Biosafety Level II conditions (BSL-2). This is true for most transgenes except for oncogenes that have to be produced in BSL-3. Therefore, production in BSL-2 conditions for most cases is sufficient. In addition, the use and the production are usually disconnected for most national regulatory agencies dealing with genetically modified organisms (GMO). Limited amounts of replication incompetent SIN lentiviral vectors (below 2 µg of p24 capsid protein) can be used under BSL-1 conditions as described by the French GMO agency in agreement with the European Union recommendations.

Access restricted. Please log in or start a trial to view this content.

Protocol

All procedures that include animal work have obtained ethical approval and have been authorized by the French Ministry of Research and Education under number APAFIS#5094-20 16032916219274 v6 and 05311.02. The ICM animal facility PHENOPARC has been accredited by the French Ministry of Agriculture under the accreditation number B75 13 19. The overall protocol requires performing each procedure within a precise time frame that is summarized in in Figure 1.

1. Animal Purchase and Preparation of Basic Compounds

  1. Animal purchase
    1. Order 25 vasectomized males B6CBAF1/JRj that are 8 weeks of age (F1 generation from original crosses between ♀C57Bl/6JRj and ♂CBA/JRj).
      NOTE: Isolate males upon arrival. Vasectomized males can be re-used for at least one year.
      Change the cages every 3 weeks.
    2. Order 50 B6CBAF1/JRj females that are 10 weeks of age and keep a pool of at least 50 animals.
    3. Order 10-15 C57BL/6JRj fertile males that are 8 weeks of age.
    4. Order 30 C57BL/6JRj females that are 4 weeks of age.
  2. Anesthesia and euthanasia
    1. Anesthesia is performed using a volume of 300μL ketamine/xylazine mix, injected intraperitoneally (ketamine at a dose of 150μg/g body weight, xylazine at a dose of 0.15μg/g body weight). Animals are placed under heating pad to adjust body temperature. Check reflexes by pinching the tail of the animal prior to start the procedure.
    2. Euthanasia was performed by cervical dislocation. Decapitation was included as a secondary method to confirm death of the animal. Euthanasia of embryos was performed by decapitation.
      NOTE: Upon arrival, allow animals a minimum of 1 week to habituate to the facility (no handling or mating). Importantly, any mouse strains including transgenic lines can be utilized as fertile males and fertile females for superovulation. The choice of strain should be made according to the requirements of the scientific question.
  3. Hormone preparation
    1. Add 910 µL of PSMG (Pregnant Mare Serum Gonadotropin) buffer into 1 lyophilized PMSG vial, make 100 µL aliquots, and store at -20 °C.
      NOTE: Each aliquot contains 55 UI for 11 mice. Never keep PMSG aliquots for more than 2 weeks after the first use.
    2. Add 2730 µL of hCG (Human Chorionic Gonadotropin) buffer into 1 lyophilized hCG vial. Make 100 µL aliquots, and store at -20 °C.
      NOTE: Each aliquot contains 55 UI for 11 mice.
  4. Hyaluronidase preparation
    1. Reconstitute 1 vial of hyaluronidase with 3 mL of M2 Medium to obtain a 10 mg/mL stock solution and make 50 µL aliquots. Then store at -20 °C.
  5. Surgery tools preparation
    1. Sterilize all surgery tools using the autoclave.

2. Superovulation of Female Donors

  1. In an animal facility using 12 h day -night cycles, inject PMSG at 2 PM on day -3. Inject hCG at 12 AM on day -1 and mate with fertile males just after hCG injection.
  2. On day -3, add 1 mL of sterile 0.9% NaCl solution into 1 aliquot of 100 µL of PMSG (55 UI). Inject 10 C57BL/6JRj females with 100 µL intraperitoneally using a syringe without any dead volume.
    NOTE: Each mouse will receive 5 UI of PMSG.
  3. On day -1, add 1 mL of sterile 0.9% NaCl solution into 1 aliquot of 100 µL of hCG (55 UI). Inject the mice that received the PMSG injection with 100 µL of diluted hCG solution (5UI) intraperitoneally. Use a syringe without any dead volume. Perform the injection slowly and wait before removing the needle so that the liquid does not leak.
    NOTE: Each mouse will receive 5 UI of hCG. Injection of hCG should be performed 46 h after PMSG.
  4. Place each C57BL/6JRj female in the cage of the stud male directly after hCG injection.
  5. Check vaginal plugs on the morning of day 0 and use the positive females to collect fertilized eggs.

3. Prepare the B6CBAF1/jRj Pseudopregnant Females

  1. Mate one vasectomized male the day before egg collection (day -1) with 2 B6CBAF1/JRj females at 5 PM.
    NOTE: It is very important to mate with females that are originating from different cages to avoid synchronization of female cycles. This will increase the yield of obtaining vaginal plugs. In addition, do not add a female to a male cage that has been changed within the past 2 days. Efficacy of reproductive behavior in the male is increased when the cage is dirty.

4. Fertilized Eggs Collection

  1. Preparation
    1. Add 1450 µL of M2 to hyaluronidase stock solution to prepare the hyaluronidase working solution.
    2. Place one drop of 100 µL of hyaluronidase working solution per female used to produce fertilized eggs in a 100 mm Petri dish and keep at room temperature.
    3. Add 500 µL of M16 into 4 wells plates. Use 2 wells per type of lentiviral vectors that will be injected: one well will contain the injected eggs and the other the non-injected ones. Place the 4 well plates in the incubator at 37 °C with a 5% CO2 atmosphere.
  2. Prepare pipettes for collection and handling of embryos.
    1. Soften the glass hematocrit capillaries (75 mm/60 µL) by rotating the center of the hard glass capillary tubing in the flame.
    2. Remove the capillaries from the heat as quickly as possible and pull to obtain a tube with an internal diameter of about 300 µm. Pull on the cooled tubing to obtain a neat break.
  3. Collect oviducts.
    1. Euthanize C57BL/6JRj females by cervical dislocation at 9 AM on day 0. Death is confirmed by decapitation.
      NOTE: This euthanasia method was approved by the IACUC and follows European recommendations.
    2. Perform a large horizontal incision to open the abdominal cavity with scissors. The oviduct is located between the uterus and the ovary.
    3. Remove the mesometrium and the membrane carrying prominent blood vessels with curved forceps.
    4. Separate the oviduct from the ovary with curved forceps.
    5. Use curved forceps as a guide to cut the oviduct from the ovary using curved scissors.
    6. Pull the oviduct and cut from the uterus with curved scissors.
      Caution: Do not touch the swollen ampulla that contains the fertilized eggs. Perform the entire procedure using sterile instruments.
    7. Place all collected oviducts in M2 medium (35 mm culture dish) at room temperature
    8. Place 2 oviducts in the same 100 µL drop of hyaluronidase working solution (0.3 mg/mL).
  4. Remove cumulus cells from fertilized eggs.
    1. Under a stereomicroscope, use 2 insulin syringes: the first one to hold the oviduct and the second one to tear up the ampulla and disperse fertilized eggs into the hyaluronidase working solution.
    2. Take the prepared glass pipet for collecting eggs and connect it to the tubing and a 0.22 μm filter mounted on the mouthpiece to aspirate all the eggs. Collect all eggs and wash them by successive passage into 6 different drops of 100 µL of M2 medium.
    3. Place washed fertilized eggs into humidified 37 °C incubator with an atmosphere of 5% CO2 in M16 medium.

5. Making Injection Pipettes

  1. Use thin-walled glass capillary tubing (10-15 cm long) with an outside diameter of 1 mm and clamp this capillary into horizontal micropipette puller.
    NOTE: In most horizontal pipette pullers, 3 parameters can be adjusted: heat power, pulling strength and time delay between heating and pulling. Adjust these parameters to obtain injecting pipets that resembles the one presented in Figure 2A. For users that are routinely performing DNA microinjection, use the standard settings and adjust the delay between heating and pulling to change the global shape of the pipette tip.

6. Making Holding Pipettes

  1. Use an injecting pipette to prepare the holding pipette.
  2. Attach an injecting pipette to a microforge. Cut the pipette with the microforge to obtain a sharp symmetrical tip of 80 to 100 µm diameter. Then polish the tip with heat on the microforge to obtain a symmetrical round shape without sharp hedges.

7. Preparation of Injection Pipette Containing the Lentiviral Vector

  1. Centrifuge the lentiviral vector suspension at 160 x g for 2 min to pellet debris often present in frozen lentiviral stocks.
  2. Recover the supernatant and transfer it into a new 0.5 mL tube in a class II safety cabinet.
  3. Transfer 1 µL of supernatant to an injection pipette prepared as described in step 5 using a Micro-loader.
  4. Set the injection pipette on the instrument holder of the right micromanipulator. Connect the holding pipet to the left micromanipulator.
    NOTE: The transduction titer of the lentiviral vector will be directly correlated with the efficacy of founder production. For high efficacy (>70%), use viral vectors with a titer in the range of 100 ng of p24 capsid protein/µL. When the titer is expressed as transduction units (TU), the titer should be above 109 TU/mL. Lentiviral vector stocks must be produced by transient transfection of 293T cells with the p8.91 encapsidation plasmid, pHCMV-G, encoding the vesicular stomatitis virus (VSV) glycoprotein-G as described in supplemental methods18.

8. Micro-Injection

  1. Dispense 8 µL of M2 medium in the center of a depression slide and cover with light paraffin oil (embryo tested) to avoid evaporation.
  2. Place 20 eggs into the drop as least dispersed as possible.
    CAUTION: Do not make bubbles when depositing the embryos.
  3. Make sure that the tip of the injection pipette is open. If not, tap the injection pipette with the holding pipette.
  4. Set the microinjector for an injection time of 20 s.
    NOTE: The viscosity of the viral suspension allows clear visualization of the dispersion of the viral vector in the perivitelline space. The injection pressure should be adjusted in order to fill the entire space within 20 s of injection, which represents a volume of 10 to 100 pL. Injection pressure should not exceed 600 hPa.
  5. Aspirate one fertilized egg that contains 2 pro nuclei and 2 polar bodies with the holding pipette under the stereomicroscope.
  6. Inject the egg with the microinjector using settings described in 8.4, in the perivitelline space.
    CAUTION: Do not touch the plasma membrane with injection pipet.
  7. Inject all fertilized eggs available in batches of 20 eggs and place the injected eggs immediately in pre-heated M16 medium into the humidified 37 °C incubator with an atmosphere of 5% CO2.
    NOTE: Incubate the injected eggs for a minimum of 30 min after injection before embryo transfers.

9. Transferring Embryos into B6CBAF1/JRj Pseudopregnant Females

  1. Check copulation plug 16 h after mating B6CBAF1/JRj females with B6CBAF1/JRj vasectomy males. Do this just before starting the egg collection.
  2. Prepare implantation pipettes for the injected embryo.
    1. Make implantation pipettes for embryos as described for collecting and handling embryos (step 4.2). Select pipettes with an internal diameter of about 150 µm with a narrow part around 4-5 cm in length.
      NOTE: The tip should be flame polished, in order to reduce possible damage to the eggs or the oviduct.
      1. Fill with light paraffin oil (embryo tested) just above the pipette shoulder.
      2. Aspirate a small air bubble, then M2 medium, and finally a second air bubble.
      3. Draw up embryos one behind each other to minimize the total volume of medium that will be injected in the oviduct along with the embryos.
      4. Finish by loading a very little drop of light paraffin oil (embryo tested) of about one embryo width.
        Caution: Be gentle while handling the pipette.
  3. Embryo transfer.
    1. Sterilize all instruments.
    2. Anesthetize the female using an intraperitoneal injection of 300 μL of sterile NaCl 0.9% solution containing 150 μg per g of body weight of Ketamine and 0.15 μg per g of body weight of Xylazine.
    3. Verify the depth of anesthesia by pinching the tail of the animal with forceps and inject subcutaneouly 0.1mg/kg of analgesic (Buprenorphine) prior to start the procedure.
    4. Shave 2 cm on both sides of the back along the spinal cord at the level of the last rib.
    5. Place the female mouse on a heating pad and in a sterile field. Cut a 2 cm x 2 cm window in the middle of the mouse back.
    6. Apply an antiseptic solution (10% Povidone iodide) on the skin and make a 1 cm transverse incision with scissors, then slide the skin laterally until the ovary (orange color) is visible through the body wall.
    7. Make a 5 mm incision into the body wall just above the ovary with the fine scissors under a binocular surgical microscope.
    8. Pick up the fat pad with an atraumatic bulldog clamp and pull out the ovary, the oviduct and the top of the uterus.
    9. Visualize the ampulla and make a hemisection with vannas scissors on the oviduct segment that links the ovary to the ampulla.
    10. Introduce the transfer embryo pipette and deliver eggs into the ampulla, stopping at the first air bubble in the implantation pipette.
    11. Repeat the procedure on the second oviduct.
    12. Close the skin up with wound clips.
    13. Place the animal in the recovery chamber (39 °C, 30-60 min) until fully awake.
    14. Repeat analgesic injection after 12 h and 48 h in case of signs of pain or distress.
    15. Remove wound clips 7-10 days after surgery.
    16. Check implanted females for pregnancy by following their weight curve every 3 days after implantation. A significant weight gain can be observed 10 to 12 days after implantation and will be indicative for pregnancy.
      NOTE: All embryos that will develop here will represent putative transgenic founders. The phenotype of these founders can be analyzed at any developmental stages or after birth according to the scientific question linked to the generation of these transgenic animals.

10. Genotyping Transgenic Founders

  1. Prepare genotyping buffer containing 10 mM Tris-HCl, pH 8; 5 mM EDTA, pH 8.0 with 0.2% SDS (w/v), 50 mM NaCl. Sterilize the genotyping buffer through a 0.22 µm filter and store at room temperature for several months.
  2. Put extraembryonic membranes (for embryos) or little piece of tail (for born animals) into 500 µL of filtered genotyping buffer and add 15 µL of proteinase K (20 mg/mL). Incubate overnight at 55 °C.
  3. Centrifuge the lysate at 15,000 x g for 5 min and then use 1 µL of supernatant for the PCR reaction. Lysate can be stored at 4 °C for several months.
  4. Perform the PCR amplification of a fragment of the transgene in a 20 µL reaction volume containing 1x PCR buffer, 1.5 mM MgCl2, 200 µM of dNTPs, 0.2 µM of each PCR primers, 1 UI of Taq DNA polymerase and 1 µL of each digested sample. As a negative control, use 1 µL of H2O. As a positive control, use DNA from the lentiviral vector plasmid containing the transgene.
  5. For detection of eGFP described use:
    eGFP Forward Primer:5' GACCACATGAAGCAGCACGACTTCT 3'
    eGFP Reverse Primer: 5' TTCTGCTGGTAGTGGTCGGCGAGCT 3'
  6. Perform PCR amplification in a thermocycler: 4 min at 94 °C followed by 35 cycles of 1 min at 94 °C, 1 min at 60 °C, and 2 min at 72 °C.
  7. Load the PCR product on a 2% agarose gel in order to visualize a 300 bp eGFP PCR product as illustrated in Figure 2B.
    NOTE: All individuals showing a 300 bp PCR band have integrated the eGFP transgene and can be considered as transgenics.
  8. Analyze transgene expression in transgenic animals. For example, perform histological and immunostaining as illustrated in Figure 3 and Figure 4 and described in supplemental methods.
    NOTE: Both transgene expression analysis and phenotype analysis should be performed using pertinent methods according to the global scientific question.

11. Quantification of Transgene Copy Number

  1. Prepare DNA samples for quantitative PCR.
    1. Extract genomic DNA (gDNA) from the Proteinase K lysate obtained in step 10.3 using a commercial kit according to manufacturer instructions.
    2. Quantify gDNA by spectrophotometry at 260 nm.
    3. Dilute each gDNA sample to a 10 ng/µL final concentration.
    4. For each sample, prepare 5 serial dilutions (1:5 ) in H2O to obtain 6 tubes at the following concentrations: 10 ng/µL, 2 ng/µL, 0.4 ng/µL, 0.08 ng/µL, 0.016 ng/µL and 0.0032 ng/µL
  2. Prepare the quantitative PCR (qPCR) reaction mix.
    1. Prepare the primer mix for qPCR. For each primer couple to use for qPCR, add 10 µL of forward primer (100 µM primer stock solution), 10 µL of reverse primer (100 µM) and 80 µL of H2O.
      NOTE: To amplify eGFP, use Forward TCCAGGAGCGCACCATCTTCTTCA and Reverse TTGATGCCGTTCTTCTGCTTGTCG primers. Cdx2 gene is used as normalizer for the qPCR (2 copies per genome). For Cdx2 normalizer use Forward GCCAGGGACTATTCAAACTACAGG and Reverse GACTTCGGTCAGTCCAGCTATCTT primers
    2. Prepare 2 qPCR mixes, one with the eGFP primer mix and one with Cdx2 primer mix. Prepare sufficient qPCR mix to amplify the 6 dilutions in duplicates of each gDNA. One qPCR reaction contains 3.8 µL of H2O, 5 µL of fluorescent green 2x reaction mix and 0.2 µL of primer mix.
      NOTE: For each transgenic animal to test, 24 qPCR reactions will be performed. The reaction mix is provided for a 384 well qPCR machine.
    3. For each animal to test, distribute: 12 wells with 9 µL of eGFP qPCR mix and 12 wells with 9 µL of Cdx2 qPCR mix. Add 1 µL of each gDNA dilution to 2 wells containing the eGFP qPCR mix and 2 wells containing the eGFP qPCR mix.
    4. Leave 2 wells for each qPCR mix in which gDNA was replace by H2O as negative control.
  3. Place the 384 well plate in the qPCR machine and apply the following running protocol: 10 min at 95 °C then 50 cycles of 10 s at 95 °C and 1 min at 60 °C.
  4. Analyze data. For each gDNA to test, plot the Ct values as a function of the Log of total gDNA amount (6 points in duplicates). Fit the curve using linear regression with the least square method and extrapolate the Ct value corresponding to the intercept with the y axis. Use the extrapolated Ct values for eGFP and the normalized Cdx2 to calculate the eGFP copy number relative to Cdx2 (2 copies) using the standard 2ΔdCt method11.

Access restricted. Please log in or start a trial to view this content.

Results

Transgenic animals were generated using the protocol presented here. Representative results both ubiquitous and cell type specific transgene expression are illustrated.

Constitutive expression of transgenes

Ubiquitous promoters are basic research tools to express transgenes in a sustained and efficient manner. Such promoters are used for a very large v...

Access restricted. Please log in or start a trial to view this content.

Discussion

The perivitelline injection of lentiviral vectors in fertilized oocytes described here resulted in the production of transgenic embryos that yielded more than 70% of transgenic embryos relative to total number of collected embryos. This result is consistent with previous reports and exemplifies the specificity of the procedure2,7,10,11,12. When comparing all t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflict of interest to disclose.

Acknowledgements

We thank Magali Dumont and Rolando Meloni for critical reading of the manuscript and the iVector and Phenoparc ICM Cores for technical assistance in lentiviral vector production and animal housing respectively. This work was supported by the Institut Hospitalo-Universitaire de Neurosciences Translationnelles de Paris, IHU-A-ICM, Investissements d'Avenir ANR-10-IAIHU-06. P.R. received funding for the Association de Langue Française pour l'Etude du Diabète et des Maladies Métaboliques (ALFEDIAM) and a joint JDRF / INSERM grant.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
PMSG 50UISigmaG4527
hCG 5000UISigmaCG5-1VL
NaClSigma7982
100 mm petri dishDutsher353003
4 wells Nunc dishDutsher56469IVF dish
M2 mediumSigmaM7167
M16 mediumSigmaM7292
0,22 µm Syringe filterDutsher146611
Hyaluronidase Enzyme 30mgSigmaH4272mouse embryo tested
Insulin seryngeVWR613-3867Terumo Myjector
Curved forcepsMoria2183
Curved scissorsMoriaMC26
Aspirator tube assemblies for calibrated microcapillary pipettesSigmaA5177-5EA
Borosilicate glass capillariesHarvard apparatusGC 100-10
Horizontal micropipette pullerNarishigePN-30
MicroforgeNarishigeMF-900
Inverted microscopeNikonTransferman NK2 5188Hoffman modulation contrast illumination is required
MicromanipulatorEppendorfCelltram air
Controler of holding pipetEppendorfFemtojet
Mineral oilSigmaM8410mouse embryo tested
MicroinjectorEppendorfFemtojetCan be used to inject DNA or viral vectors
Dumont # 5 forcepsMoriaMC 40
vannas micro scissorsMoria9600
IsofluranecentravetISO005ISO-VET 100% 250ml
ocrygelcentravetOCR002
Povidone iodurecentravetVET001vetedine 120ml
BuprenorphinecentravetBUP002Buprecare 0,3Mg/ml 10ml
Tris-HClSigmaT5941Trizma hydrochloride
EDTASigmaE9884
SDSSigma436143
NaClSigmaS7653powder
proteinase KSigmaP2308 
oneTaq kitNEBM0480L
PrimersEurogentec
Strip of 8 PCR tube4titude4ti-0781
96 well thermal cyclerApplied Biosystems4375786Veriti
Genomic DNA mini kitinvitrogenK1820-02
Nanodrop 2000Thermo ScientificND-2000C 
qPCR Master mixRoche4887352001SYBR Green 
Multiwell plate 384Roche5217555001
qPCR instrument 384 wellRoche5015243001LightCycler 480

References

  1. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proceedings of the National Academy of Science USA. 77 (12), 7380-7384 (1980).
  2. Bock, T. A., Orlic, D., Dunbar, C. E., Broxmeyer, H. E., Bodine, D. M. Improved engraftment of human hematopoietic cells in severe combined immunodeficient (SCID) mice carrying human cytokine transgenes. Journal of Experimental Medicine. 182 (6), 2037-2043 (1995).
  3. Miyakawa, Y., et al. Establishment of human granulocyte-macrophage colony stimulating factor producing transgenic SCID mice. British Journal of Haematology. 95 (3), 437-442 (1996).
  4. Hirabayashi, M., et al. A comparative study on the integration of exogenous DNA into mouse, rat, rabbit, and pig genomes. Experimental Animals. 50 (2), 125-131 (2001).
  5. Isola, L. M., Gordon, J. W. Transgenic animals: a new era in developmental biology and medicine. Biotechnology. 16, 3-20 (1991).
  6. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., Trono, D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology. 15 (9), 871-875 (1997).
  7. Lois, C., Hong, E. J., Pease, S., Brown, E. J., Baltimore, D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 295 (5556), 868-872 (2002).
  8. Ewerling, S., et al. Evaluation of laser-assisted lentiviral transgenesis in bovine. Transgenic Research. 15 (4), 447-454 (2006).
  9. Ritchie, W. A., Neil, C., King, T., Whitelaw, C. B. Transgenic embryos and mice produced from low titre lentiviral vectors. Transgenic Research. 16 (5), 661-664 (2007).
  10. Park, F. Lentiviral vectors: are they the future of animal transgenesis. Physiological Genomics. 31 (2), 159-173 (2007).
  11. van Arensbergen, J., et al. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element. PLoS One. 12 (2), e0171508(2017).
  12. Friedli, M., et al. A systematic enhancer screen using lentivector transgenesis identifies conserved and non-conserved functional elements at the Olig1 and Olig2 locus. PLoS One. 5 (12), e15741(2010).
  13. Sauvain, M. O., et al. Genotypic features of lentivirus transgenic mice. Journal of Virology. 82 (14), 7111-7119 (2008).
  14. Punzon, I., Criado, L. M., Serrano, A., Serrano, F., Bernad, A. Highly efficient lentiviral-mediated human cytokine transgenesis on the NOD/scid background. Blood. 103 (2), 580-582 (2004).
  15. Zennou, V., et al. The HIV-1 DNA flap stimulates HIV vector-mediated cell transduction in the brain. Nature Biotechnology. 19 (5), 446-450 (2001).
  16. Miyoshi, H., Blomer, U., Takahashi, M., Gage, F. H., Verma, I. M. Development of a self-inactivating lentivirus vector. Journal of Virology. 72 (10), 8150-8157 (1998).
  17. Yee, J. K., et al. A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes. Proceedings of the National Academy of Science USA. 91 (20), 9564-9568 (1994).
  18. Castaing, M., et al. Efficient restricted gene expression in beta cells by lentivirus-mediated gene transfer into pancreatic stem/progenitor cells. Diabetologia. 48 (4), 709-719 (2005).
  19. Gradwohl, G., Dierich, A., LeMeur, M., Guillemot, F. neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proceedings of the National Academy of Science USA. 97 (4), 1607-1611 (2000).
  20. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proceedings of the National Academy of Science USA. 88 (11), 4626-4630 (1991).
  21. Norrman, K., et al. Quantitative comparison of constitutive promoters in human ES cells. PLoS One. 5 (8), e12413(2010).
  22. Vandegraaff, N., Kumar, R., Burrell, C. J., Li, P. Kinetics of human immunodeficiency virus type 1 (HIV) DNA integration in acutely infected cells as determined using a novel assay for detection of integrated HIV DNA. Journal of Virology. 75 (22), 11253-11260 (2001).
  23. Ohtsuka, M., et al. One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT). BMC Genomics. 16, 274(2015).
  24. Tasic, B., et al. Site-specific integrase-mediated transgenesis in mice via pronuclear injection. Proceedings of the National Academy of Science USA. 108 (19), 7902-7907 (2011).
  25. Sumiyama, K., Kawakami, K., Yagita, K. A simple and highly efficient transgenesis method in mice with the Tol2 transposon system and cytoplasmic microinjection. Genomics. 95 (5), 306-311 (2010).
  26. Garrels, W., et al. Cytoplasmic injection of murine zygotes with Sleeping Beauty transposon plasmids and minicircles results in the efficient generation of germline transgenic mice. Biotechnology Journal. 11 (1), 178-184 (2016).
  27. Ding, S., et al. Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice. Cell. 122 (3), 473-483 (2005).
  28. Aida, T., et al. Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in mice. Genome Biology. 16, (2015).
  29. Philippe, S., et al. Lentiviral vectors with a defective integrase allow efficient and sustained transgene expression in vitro and in vivo. Proceedings of the National Academy of Science USA. 103 (47), 17684-17689 (2006).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Lentiviral TransgenesisPerivitelline InjectionFounder AnimalsLentiviral VectorsMicroinjection TechniqueEmbryo TransferOviduct DissectionM16 MediumM2 Medium