A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

10.9K views

DOI:

10.3791/57800

August 25th, 2018

* These authors contributed equally

In This Article

Summary

A simple, versatile, and low-cost in vitro hydroponic system was successfully optimized, enabling large-scale experiments under sterile conditions. This system facilitates the application of chemicals in a solution and their efficient absorption by roots for molecular, biochemical, and physiological studies.

Abstract

A wide range of studies in plant biology are performed using hydroponic cultures. In this work, an in vitro hydroponic growth system designed for assessing plant responses to chemicals and other substances of interest is presented. This system is highly efficient in obtaining homogeneous and healthy seedlings of the C3 and C4 model species Arabidopsis thaliana and Setaria viridis, respectively. The sterile cultivation avoids algae and microorganism contamination, which are known limiting factors for plant normal growth and development in hydroponics. In addition, this system is scalable, enabling the harvest of plant material on a large scale with minor mechanical damage, as well as the harvest of individual parts of a plant if desired. A detailed protocol demonstrating that this system has an easy and low-cost assembly, as it uses pipette racks as the main platform for growing plants, is provided. The feasibility of this system was validated using Arabidopsis seedlings to assess the effect of the drug AZD-8055, a chemical inhibitor of the target of rapamycin (TOR) kinase. TOR inhibition was efficiently detected as early as 30 min after an AZD-8055 treatment in roots and shoots. Furthermore, AZD-8055-treated plants displayed the expected starch-excess phenotype. We proposed this hydroponic system as an ideal method for plant researchers aiming to monitor the action of plant inducers or inhibitors, as well as to assess metabolic fluxes using isotope-labeling compounds which, in general, requires the use of expensive reagents.

Introduction

The advantages of growing plants using hydroponics have been widely recognized in the production of large and uniform plants, enabling reproducible experiments1,2,3. In this system, the composition of the nutritive solution can be properly controlled and recycled along all stages of plant growth and development. Furthermore, roots are not subjected to abiotic stresses, as can happen in soil-grown plants, such as nutrient starvation and water deficiency4. As plants grown hydroponically present morphological and physiological traits fairly similar to the ones cultured in soil, this system has been broadly employed in research because it allows the monitoring of root/shoot growth and their harvesting without injuries2,5.

Due to the possibility of changing the composition and concentration of the nutritive solution, most of the research using hydroponic conditions has been performed to characterize the functions of micro- and macronutrients1,3,6,7,8. However, this system has proved to be very useful to a broad range of applications in plant biology, such as to elucidate the functions of hormones and chemicals in plants. For instance, the discovery of strigolactones as a new class of hormones9 and the accelerated growth phenotype triggered by brassinosteroid application10 were performed under hydroponic conditions. Moreover, this system enables experiments with labeled isotopes (e.g., 14N/15N and 13CO2)11,12 to evaluate their incorporation into proteins and metabolites by mass spectrometry.

Considering the importance of this system in plant research, a high number of hydroponic cultures has been designed in the last few years, including systems that use (i) the transference of seedlings from plates to hydroponic containers3,13; (ii) rockwool that limits access to the early stages of root development2,14,15; (iii) polyethylene granulate as the floating body, which makes the homogeneous application of small molecules/treatments difficult16; or (iv) a reduced number of plants9,17. The volume of hydroponic tanks described in many of those protocols are usually large (small volumes ranging from 1 - 5 L, up to 32 L)18, which makes the application of chemicals extremely expensive. Although few studies do describe a hydroponic cultivation under aseptic conditions8,19, the assembly of the system is usually quite laborious, consisting of the perfect adjustment of nylon meshes into plastic or glass containers5,8,17,20.

Due to the importance of Arabidopsis thaliana as a model plant, the majority of hydroponics systems were designed for this species1,2,8,14,18,19,20. Nevertheless, there are a few studies reporting the hydroponic growth features of other plant species with a pretreatment of seeds to improve their germination and synchronization rates in vitro8,16. In order to work on a large scale, we developed a protocol for setting up a simple and low-cost maintenance hydroponic system that enables sterile conditions for growing plants, including A. thaliana and other species, such as the grass Setaria viridis. The method described here is suitable for different experiments, as the seedling growth can be maximized, synchronized, and easily monitored. Furthermore, this system has many advantages as: (i) its assembly is straightforward and its components can be reused; (ii) it allows the easy application of different chemicals into the liquid medium; (iii) the seedlings germinate and grow directly in the culture medium without the need of transference to the hydroponics system; (iv) the shoot and root development/growth can be closely supervised and the seedlings are harvested without damages; and (v) it makes it possible to work on a large scale, maintaining physiological conditions.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparation of Liquid and Solid Culture Media

  1. Prepare a liquid medium using half-strength Murashige and Skoog (MS) medium with vitamins [0.0125 mg/L of cobalt(II) chloride pentahydrate, 0.0125 mg/L of copper(II) sulfate pentahydrate, 18.35 mg/L of ethylenediaminetetraacetate ferric sodium, 3.10 mg/L of boric acid, 0.415 mg/L of potassium iodide, 8.45 mg/L of manganese sulfate monohydrate, 0.125 mg/L of sodium molybdate dihydrate, 4.30 mg/L of zinc sulfate heptahydrate, 166.01 mg/L of calcium chloride, 85 mg/L of potassium dihydrogen phosphate, 950 mg/L of potassium nitrate, 90.27 mg/L of magnesium sulfate, 825 mg/L of ammonium nitrate, 1 mg/L of glycine, 50 mg/L of myo-inositol, 0.25 mg/L of nicotinic acid, 0.25 mg/L of pyridoxine hydrochloride, and 0.05 mg/L of thiamine hydrochloride] supplemented with 0.25 g/L of MES, and adjust the pH to 5.8 with 10 M KOH.
  2. Add 10 g/L of agar to make a half-strength MS-solid medium. Autoclave the medium at 121 °C for 20 min prior to use.

2. Hydroponic System Assembling

NOTE: These steps should be followed meticulously to build the hydroponic system.

  1. Material sterilization
    1. Pack in the autoclave bag the pipette tip racks (without covers) that will be used as minitanks. Autoclave the racks at 121 °C for 20 min, 15 psi.
      NOTE: The polypropylene pipette tip rack we used had the following dimensions: 120 mm (length) x 89 mm (width) x 55 mm (height). The pipette tip flat surface must have an area for the addition of culture medium. Other tip racks can be used (see Table of Materials).
      NOTE: Throughout the assembly procedure of the hydroponic system, it is necessary to use a laminar flow hood, which must be cleaned and disinfected with 70% ethanol prior to use. The experimenter must wear a lab coat, wash their hands and any exposed skin, and disinfect them with 70% ethanol. Gloves are optional, except for drug application.
    2. Clean all the accessories described above (disposable plastic boxes, adhesive tape, pipettes, scissors, and tweezers) with 70% ethanol before entering the laminar flow hood. If the hood allows, turn on the UV light for 10 min prior to the assembling of the hydroponic system in order to keep the work area decontaminated.
  2. Minitank assembling
    1. Seal the upper surface of the pipette tip flat with adhesive tape (Figure 1B). If possible, leave it under UV light for 10 min.
    2. Add 180 µL of melted solid MS culture medium (slightly warm) to each well using a multichannel pipette (Figure 1C).
      NOTE: When preparing many tanks, use a hotplate to prevent the MS medium from solidifying.
    3. Allow the medium to solidify completely (for about 30 min).
      NOTE: During the solidification period, the UV light can be turned on.
    4. Fill up the pipette tip rack completely with liquid MS culture medium (Figure 1D) and ensure there is close contact between the solid and the liquid media.
    5. Remove the adhesive tapes of the upper surface of the pipette tip flat and fit it on the rack carefully. The hydroponic system is now ready to receive the sterilized seeds.

3. Seed Sterilization

  1. Place 500 Arabidopsis seeds in a 1.5 mL microtube. Use as many microtubes as necessary according to the number of plants required for the experiment.
  2. Wash the seeds with 70% ethanol for 2 min with a gentle agitation. Let the seeds settle down, then remove the ethanol carefully.
  3. Add 1 mL of a 10% sodium hypochlorite solution containing 2 µL of a polysorbate 20 detergent. Agitate the solution for 5 min. Remove the solution carefully.
  4. Rinse the seeds with sterile distilled water until all the bleach residue is completely removed (approximately 5x).
    NOTE: After the surface sterilization, the seeds were immersed in sterile distilled water and stratified at 4 °C in the dark for 5 d to synchronize the germination.
    NOTE: Seeds of Setaria viridis (accession A10.1) were preincubated in concentrated sulfuric acid for 15 min (to break the physical dormancy), washed thoroughly in sterile distilled water, and then disinfested with a 5% sodium hypochlorite solution containing 0.1% polysorbate 20 for 5 min with a gentle agitation21. The remaining sterilization steps were identical to those described for Arabidopsis seeds.

4. Seed Application

  1. Cut slightly the extremity of a 200 µL tip with the aid of a sterile scalpel.
  2. Pipette the Arabidopsis seeds into the solid culture medium on the upper surface of the pipette tip flat. Take care that the medium does not loosen from the flat; otherwise, the seeds will be shaded and the seedlings will not grow properly (Figure 1E).
    NOTE: Use a sterile tweezer for Setaria seeds (with the embryo positioned upward).
  3. Store as many minitanks as possible inside a disposable plastic box to maintain a high humidity and keep the environment free from microorganisms (Figure 1F).
  4. Seal the disposable plastic box thoroughly using adhesive tape to avoid contamination.
  5. Place the hydroponic systems into a growth chamber with the appropriate growth conditions for the plant of interest.
    NOTE: In this work, the following conditions were used: 75% of humidity, and 150 µmol m-2 s-1 of irradiance and equinoctial conditions of 12 h light (21 °C)/12 h dark (19 °C) for Arabidopsis, or 300 µmol m-2 s-1 of irradiance and 12 h light (28 °C)/12 h dark (25 °C) for Setaria (Figure 1G and 1H).

5. Validating the Use of this Hydroponic System to Inhibit the Target of Rapamycin Kinase

Note: This hydroponic system was initially developed to facilitate the administration of chemicals to plants, which, in general, are very expensive to be applied in large-scale experiments. As a proof of concept, the ATP-competitive inhibitor AZD-8055, which is known to specifically target the ATP binding site of the TOR protein kinase22, was employed to follow the repression of TOR activity in seedlings of A. thaliana Columbia-0 (The Nottingham Arabidopsis Stock Centre, NASC ID: N22681). Here, the protocol used is briefly described.

  1. Grow seeds hydroponically until stage 1.04 according to the BBCH scale23 (for about 11 d) under the climatic conditions described above. Replace the nutrient solution, either with fresh medium containing 0.05% DMSO (control), 2 µM AZD-8055 (TOR inhibitor) diluted in DMSO, or without treatment (mock), at the end of the night (EN).
  2. Harvest some seedlings at different time points after the treatment and separate them into roots and shoots. Freeze the samples in liquid nitrogen, grind them to a fine powder in a robotic grinder (see Table of Materials), and store the powder at -80 °C until use.
  3. Immunoblot against phosphorylated and non-phosphorylated forms of 40S ribosomal protein S6 (RPS6) according to Dobrenel et al.24.
  4. Bleach intact seedlings for sample depigmentation, wash them in distilled water, immerse them in an iodine solution for 5 min25, and photograph the seedlings in a stereomicroscope (0.63X objective, 20x approximation, and 7.5x magnitude) for a qualitative assessment of the starch content.
  5. Quantify the starch following the enzymatic degradation and measurement of the released glucose spectrophotometrically by coupling it to the reduction of NADP+ to NADPH26,27.
  6. Perform a total RNA extraction, a cDNA synthesis, and quantitative RT-PCR assays as described by Caldana et al.28 to evaluate the expression level of genes related to different sorts of stresses.
  7. Optionally, grow seedlings on a horticultural substrate in plastic pots with a 0.1 L capacity under similar climatic conditions [60 % of humidity, 150 µmol m-2 s-1 of irradiance, and equinoctial conditions of 12 h light (21 °C)/12 h dark (19 °C)] in order to compare them with seedlings grown hydroponically.
    NOTE: The target genes used for the gene expression assays were ABF3 (At4g34000), ASN1 (At3g47340), and TPS5 (At4g17770), and their expression levels were normalized employing the delta-Ct method29 using ACT2 (At3g18780) or PDF2 (At4g04890) as the internal reference genes, assuming 100% of PCR amplification efficiency across all samples. The oligonucleotide pairs used for the quantitative PCR were: ABF3 (GTTCTCAACCTGCAACACAGTGC; TCCAGGAGATACTGCTGCAACC), ASN1 (AGGTGCGGACGAGATCTTTG; GTGAAGAGCCTTGATCTTGC), TPS5 (CTGCTCTGATGCTCCTTCTTCC; AAGCTGGTTTCCAACGATGATG), ACT2 (CGTACAACCGGTATTGTGCTGG; CTCTCTCTGTAAGGATCTTCATG), and PDF2 (TAACGTGGCCAAAATGATGC; GTTCTCCACAACCGCTTGGT).

Access restricted. Please log in or start a trial to view this content.

Results

The TOR kinase is a major regulator that integrates nutrient and energy signaling to promote cell proliferation and growth in all eukaryotes. Efforts to elucidate TOR functions in plants include the generation of Arabidopsis transgenic lines containing TOR conditional repression through RNA interference or artificial microRNA28,30,31, given the embryo lethal phenotype of TOR knockout pla...

Access restricted. Please log in or start a trial to view this content.

Discussion

This optimized hydroponic structure enables the successful in vitro culture of plants. Seeds germinate well on the solid medium at the pipette tip flat surface, a considerable gain in comparison to systems where seeds are soaked with the nutrient solution. A great advantage of this system is that during the seedling development, roots get directly in contact with the liquid medium without the need of transference. Moreover, chemical treatment can be easily applied in the liquid medium in a reduced volume. Humidi...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by the São Paulo Research Foundation (FAPESP; Grant 12/19561-0) and the Max Planck Society. Elias F. Araújo (FAPEMIG 14/30594), Carolina C. Monte-Bello (FAPESP; Grant 14/10407-3), Valéria Mafra (FAPESP; Grant 14/07918-6), and Viviane C. H. da Silva (CAPES/CNPEM 24/2013) are grateful for the fellowships. The authors thank Christian Meyer from the Institut Jean Pierre Bourgin (INRA, Versailles, France) for generously providing antibodies against RPS6. The authors thank RTV UNICAMP and Ed Paulo Aparecido de Souza Manoel for their technical support during the audio recording.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
EthanolMerck100983
Sodium hypochlorite solutionSigma-Aldrich425044
Polysorbate 20  Sigma-AldrichP2287
Murashige and Skoog (MS) medium including vitamins Duchefa BiochemieM0222
2-(N-morpholino)ethanesulfonic acid (MES) monohydrateDuchefa BiochemieM1503
Agar Sigma-AldrichA7921
Potassium hydroxideSigma-Aldrich484016
Laminar flow hoodTelstarBH-100
HotplateARECF20510011
Growth chamberWeiss TechnikHGC 1514
Glass Petri dish (150 mm x 25 mm)Uniglass189.006
200 μL pipette tip racks KasviK8-200-5 *
300 μL multichannel pipetteEppendorf3122000060
300 μL pipette tipsEppendorf30073088
200 μL pipette Eppendorf3120000054
200 μL pipette tipsEppendorf30000870
ScissorsTramontina25912/108
TweezerABC Instrumentos702915
Scalpel bladeSigma-AldrichS2771
Adhesive transparent tape (45mm x 50m)Scotch 3M5803
Disposable plastic boxes, external dimensions: 353 mm (L)x 178 mm (W) x 121mm (H)Maxipac32771

References

  1. Conn, S. J., et al. Protocol: Optimising hydroponic growth systems for nutritional and physiological analysis of Arabidopsis thaliana and other plants. Plant Methods. 9, 4(2013).
  2. Gibeaut, D. M., Hulett, J., Cramer, G. R., Seemann, J. R. Maximal Biomass of Arabidopsis thaliana Using a Simple, Low-Maintenance Hydroponic Method and Favorable Environmental Conditions. Plant Physiology. 115, 317-319 (1997).
  3. Nguyen, N. T., McInturf, S. A., Mendoza-Cózatl, D. G. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements. Journal of Visualized Experiments. (113), e54317(2016).
  4. Koevoets, I. T., Venema, J. H., Elzenga, J. T. M., Testerink, C. Roots Withstanding their Environment: Exploiting Root System Architecture Responses to Abiotic Stress to Improve Crop Tolerance. Frontiers in Plant Science. 7, 1335(2016).
  5. Arteca, R. N., Arteca, J. M. A novel method for growing Arabidopsis thaliana plants hydroponically. Physiologia Plantarum. 108, 188-193 (2000).
  6. Wang, R., Okamoto, M., Xing, X., Crawford, N. M. Microarray analysis of the nitrate response in Arabidopsis roots and shoots reveals over 1,000 rapidly responding genes and new linkages to glucose, trehalose-6-phosphate, iron, and sulfate metabolism. Plant Physiology. 132, 556-567 (2003).
  7. Hirai, M. Y., et al. Integration of transcriptomics and metabolomics for understanding of global responses to nutritional stresses in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America. 101, 10205-10210 (2004).
  8. Alatorre-Cobos, F., et al. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions. BMC Plant Biology. 14, 69(2014).
  9. Umehara, M., et al. Inhibition of shoot branching by new terpenoid plant hormones. Nature. 455, 195-200 (2008).
  10. Arteca, J. M., Arteca, R. N. Brassinosteroid-induced exaggerated growth in hydroponically grown Arabidopsis plants. Physiologia Plantarum. 112, 104-112 (2001).
  11. Bindschedler, L. V., Palmblad, M., Cramer, R. Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. Phytochemistry. 69, 1962-1972 (2008).
  12. Huege, J., et al. GC-EI-TOF-MS analysis of in vivo carbon-partitioning into soluble metabolite pools of higher plants by monitoring isotope dilution after 13CO2 labelling. Phytochemistry. 68, 2258-2272 (2007).
  13. Berezin, I., Elazar, M., Gaash, R., Avramov-Mor, M., Shaul, O. The Use of Hydroponic Growth Systems to Study the Root and Shoot Ionome of Arabidopsis thaliana. Hydroponics: A Standard Methodology for Plant Biological Researches. Asao, T. , InTechOpen. 135-152 (2012).
  14. Smeets, K., et al. Critical evaluation and statistical validation of a hydroponic culture system for Arabidopsis thaliana. Plant Physiology and Biochemistry. 46, 212-218 (2008).
  15. Huttner, D., Bar-zvi, D. An improved, simple, hydroponic method for growing Arabidopsis thaliana. Plant Molecular Biology Reporter. 21, 59-63 (2003).
  16. Battke, F., Schramel, P., Ernst, D. A novel method for in vitro culture of plants: Cultivation of barley in a floating hydroponic system. Plant Molecular Biology Reporter. 21, 405-409 (2003).
  17. Negi, M., Sanagala, R., Rai, V., Jain, A. Deciphering Phosphate Deficiency-Mediated Temporal Effects on Different Root Traits in Rice Grown in a Modified Hydroponic System. Frontiers in Plant Science. 7, 550(2016).
  18. Tocquin, P., et al. A novel high efficiency, low maintenance, hydroponic system for synchronous growth and flowering of Arabidopsis thaliana. BMC Plant Biology. 3, 2(2003).
  19. Schlesier, B., Bréton, F., Mock, H. P. A hydroponic culture system for growing Arabidopsis thaliana plantlets under sterile conditions. Plant Molecular Biology Reporter. 21, 449-456 (2003).
  20. Norén, H., Svensson, P., Andersson, B. A convenient and versatile hydroponic cultivation system for Arabidopsis thaliana. Physiologia Plantarum. 121, 343-348 (2004).
  21. Martins, P. K., Ribeiro, A. P., da Cunha, B. A. D. B., Kobayashi, A. K., Molinari, H. B. C. A simple and highly efficient Agrobacterium-mediated transformation protocol for Setaria viridis. Biotechnology Reports. 6, 41-44 (2015).
  22. Montané, M. H., Menand, B. ATP-competitive mTOR kinase inhibitors delay plant growth by triggering early differentiation of meristematic cells but no developmental patterning change. Journal of Experimental Botany. 64, 4361-4374 (2013).
  23. Boyes, D. C., et al. Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. The Plant Cell. 13, 1499-1510 (2001).
  24. Dobrenel, T., et al. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic. Frontiers in Plant Science. 7, 1611(2016).
  25. Lunn, J. E., Furbank, R. T. Localisation of sucrose-phosphate synthase and starch in leaves of C4 plants. Planta. 202, 106-111 (1997).
  26. Hendriks, J. H. M., Kolbe, A., Gibon, Y., Stitt, M., Geigenberger, P. ADP-Glucose Pyrophosphorylase Is Activated by Posttranslational Redox-Modification in Response to Light and to Sugars in Leaves of Arabidopsis and Other Plant Species. Plant Physiology. 133, 838-849 (2003).
  27. Stitt, M., Lilley, R. M., Gerhardt, R., Heldt, H. W. Metabolite levels in specific cells and subcellular compartments of plant leaves. Methods in Enzymology. Fleischer, S., Fleischer, B. 174, Academic Press. Amsterdam, The Netherlands. 518-552 (1989).
  28. Caldana, C., et al. Systemic analysis of inducible target of rapamycin mutants reveal a general metabolic switch controlling growth in Arabidopsis thaliana. The Plant Journal. 73, 897-909 (2013).
  29. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, 402-408 (2001).
  30. Dobrenel, T., et al. Sugar metabolism and the plant target of rapamycin kinase: a sweet operaTOR? Frontiers in Plant Science. 4, 93(2013).
  31. Moreau, M., et al. Mutations in the Arabidopsis homolog of LST8/GβL, a partner of the target of Rapamycin kinase, impair plant growth, flowering, and metabolic adaptation to long days. The Plant Cell. 24, 463-481 (2012).
  32. Deprost, D., et al. The Arabidopsis TOR kinase links plant growth, yield, stress resistance and mRNA translation. EMBO Reports. 8, 864-870 (2007).
  33. Menand, B., et al. Expression and disruption of the Arabidopsis TOR (target of rapamycin) gene. Proceedings of the National Academy of Sciences of the United States of America. 99, 6422-6427 (2002).
  34. Mahfouz, M. M., Kim, S., Delauney, A. J., Verma, D. P. Arabidopsis TARGET OF RAPAMYCIN Interacts with RAPTOR, Which Regulates the Activity of S6 Kinase in Response to Osmotic Stress Signals. The Plant Cell. 18, 477-490 (2006).
  35. Zhang, R., et al. ScFKBP12 bridges rapamycin and AtTOR in Arabidopsis. Plant Signaling & Behavior. 8, e26115(2013).
  36. Schepetilnikov, M., et al. TOR and S6K1 promote translation reinitiation of uORF-containing mRNAs via phosphorylation of eIF3h. The EMBO Journal. 32, 1087-1102 (2013).
  37. Schepetilnikov, M., et al. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation. The EMBO Journal. 30, 1343-1356 (2011).
  38. Xiong, Y., et al. Glucose-TOR signalling reprograms the transcriptome and activates meristems. Nature. 496, 181-186 (2013).
  39. Creff, A., Sormani, R., Desnos, T. The two Arabidopsis RPS6 genes, encoding for cytoplasmic ribosomal proteins S6, are functionally equivalent. Plant Molecular Biology. 73, 533-546 (2010).
  40. Turck, F., Zilbermann, F., Kozma, S. C., Thomas, G., Nagy, F. Phytohormones participate in an S6 kinase signal transduction pathway in Arabidopsis. Plant Physiology. 134, 1527-1535 (2004).
  41. Gibon, Y., et al. Adjustment of diurnal starch turnover to short days: Depletion of sugar during the night leads to a temporary inhibition of carbohydrate utilization, accumulation of sugars and post-translational activation of ADP-glucose pyrophosphorylase in the followin. Plant Journal. 39, 847-862 (2004).
  42. Smith, A. M., Stitt, M. Coordination of carbon supply and plant growth. Plant, Cell & Environment. 30, 1126-1149 (2007).
  43. Smith, A. M., Zeeman, S. C., Smith, S. M. Starch Degradation. Annual Review of Plant Biology. 56, 73-98 (2005).
  44. Orzechowski, S. Starch metabolism in leaves. Acta Biochimica Polonica. 55, 435-445 (2008).
  45. Gibon, Y., et al. Adjustment of growth, starch turnover, protein content and central metabolism to a decrease of the carbon supply when Arabidopsis is grown in very short photoperiods. Plant, Cell & Environment. 32 (7), 859-874 (2009).
  46. Kim, J. B., Kang, J. Y., Soo, Y. K. Over-expression of a transcription factor regulating ABA-responsive gene expression confers multiple stress tolerance. Plant Biotechnology Journal. 2, 459-466 (2004).
  47. Vishwakarma, K., et al. Abscisic Acid Signaling and Abiotic Stress Tolerance in Plants: A Review on Current Knowledge and Future Prospects. Frontiers in Plant Science. 8, 161(2017).
  48. Yoshida, T., et al. Four Arabidopsis AREB/ABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress. Plant, Cell & Environment. 38, 35-49 (2015).
  49. Koch, K. E. Carbohydrate-Modulated Gene Expression in Plants. Annual Review of Plant Physiology and Plant Molecular Biology. 47, 509-540 (1996).
  50. Price, J., Laxmi, A., St Martin, S. K., Jang, J. C. Global transcription profiling reveals multiple sugar signal transduction mechanisms in Arabidopsis. The Plant Cell. 16, 2128-2150 (2004).
  51. Thimm, O., et al. mapman: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. The Plant Journal. 37, 914-939 (2004).
  52. Bläsing, O. E., et al. Sugars and Circadian Regulation Make Major Contributions to the Global Regulation of Diurnal Gene Expression in Arabidopsis. The Plant Cell. 17, 3257-3281 (2005).
  53. Osuna, D., et al. Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. The Plant Journal. 49, 463-491 (2007).
  54. Yadav, U. P., et al. The sucrose-trehalose 6-phosphate (Tre6P) nexus: specificity and mechanisms of sucrose signalling by Tre6P. Journal of Experimental Botany. 65, 1051-1068 (2014).
  55. Brutnell, T. P., et al. Setaria viridis: A Model for C4 Photosynthesis. The Plant Cell. 22, 2537-2544 (2010).
  56. Altman, N., Krzywinski, M. Points of Significance: Clustering. Nature Methods. 14, 545-546 (2017).
  57. Pratelli, R., Boyd, S., Pilot, G. Analysis of amino acid uptake and translocation in Arabidopsis with a low-cost hydroponic system. Journal of Plant Nutrition and Soil Science. 179, 286-293 (2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Plant GrowthArabidopsis ThalianaSetaria ViridisTOR InhibitionAZD 8055Starch Excess PhenotypePipette Racks