We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.
Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.
Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.
To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq — chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA — we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.
Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.
Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.
Access restricted. Please log in or start a trial to view this content.
All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.
1. Tissue dissection
2. Cell fixation
Note: We used a handy cryogenic grinder for this step. An alternative apparatus can be used.
3. Chromatin Shearing
4. Quality check of DNA (Reverse Crosslinking)
5. Affinity purification by anti-FLAG antibody
Note: For neuron tChIP-Seq, brain tissues from 8 mice are typically used for one sample of tChIP-Seq to prepare 2 ng of purified DNA by tandem immune-purification (see Step 7.1). In our hands, 0.1 ng of DNA still provided high-quality DNA libraries for ChIP-Seq (Kadota, unpublished). Thus, in theory, a single mouse may be sufficient to perform neuron tChIP-Seq. The required amount should be optimized for the tissue and cell type of interest. For the negative control of the imumuno-purification experiment, brain tissue lysate from mice without any H2B-FLAG expression should be prepared and used.
6. Affinity Purification by Anti-H3K4me3 Antibody and Reverse Crosslinking
Note: The following bead preparation Steps (6.1–6.4) should be performed before Step 5.7.
7. Library Construction
8. Sequencing
Access restricted. Please log in or start a trial to view this content.
Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...
Access restricted. Please log in or start a trial to view this content.
Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.
A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects "Cellular Evolution" and all RIKEN project "Disease and Epigenome" from RIKEN (to S.N. and S.I.).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
| Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
| DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
| 8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
| SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
| Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
| 2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
| 2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
| 16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
| Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
| D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
| HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
| 5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| 0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
| NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
| Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
| Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
| 0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
| Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
| RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
| milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
| Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
| UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
| RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
| Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
| Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
| Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
| Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
| Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
| 10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
| Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
| Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
| Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
| Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
| 0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
| Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
| AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
| Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
| Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
| 2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
| Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
| High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
| KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
| NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
| KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
| 2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
| Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
| 386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
| QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
| MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
| MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
| End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
| A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
| Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
| Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
| PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
| Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
| DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
| Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |
Access restricted. Please log in or start a trial to view this content.