Method Article

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

DOI:

10.3791/58298

⸱

January 23rd, 2019

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.

To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is e....

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.

1. Tissue dissection

  1. Dissect the tissues of interest into small pieces (approximately <3 mm2) using fine spring scissors.
    Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.
  2. Add the dissected tissue fragments to a clean container filled with liquid nitrogen and collect them into 2 mL tubes (1 piece per tube) filled with liquid nitrogen.
    Note: Tube....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.

A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects "Cellular Evolution" and all RIKEN project "Disease and Epigenome" from RIKEN (to S.N. and S.I.).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Protein LoBind tube, 2 mLEppendorfNo. 0030108132For cell lysis
Protein LoBind tube, 1.5 mLEppendorfNo. 0030108116For ChIP and library preparation
DNA LoBind tube, 1.5 mLEppendorfNo. 0030108051For ChIP and library preparation
8-strip PCR tubeBIO-BIK3247-00For ChIP and library preparation
SK MillTOKKENSK-200Handy cryogenic grinder to make cell powder for fixation
Metal bulletTOKKENSK-100-DLC10Accessory of SK Mill
2 mL stainless steel tubeTOKKENTK-AM5-SUSAn option for cell lysis
2 mL stainless steel tube holderTOKKENSK-100-TLAn option for cell lysis
16% formaldehyde (w/v), methanol-freePierce28906To fix cells. Prepare 1% solution before use.
GlycineNacalai Tesque17109-35Prepare 2.5 M stock
D-PBS (-)(1x)Nacalai Tesque14249-24For washing lysate and purified DNA
HEPESNacalai Tesque02443-05For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.
5 M NaCl, molecular biology gradeNacalai Tesque06900-14For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
0.5 M EDTA, molecular biology gradeWako Pure Chemical Industries, Ltd.311-90075For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
GlycerolWako Pure Chemical Industries, Ltd.072-04945For lysis buffer 1
NP-40Nacalai Tesque25223-75For lysis buffer 1
Triton X-100, molecular biology gradeNacalai Tesque12967-32For Lysis buffer 1
TrisNacalai Tesque35406-91For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.
0.1 M EGTA pH neutralNacalai Tesque08947-35For Lysis Buffer 2
Protease inhibitor cocktail (100x)Nacalai Tesque25955-24To block degradation of protein
RIPA bufferThermo Fisher Scientific89900For cell lysis and washing
milliTUBE 1 mL AFA FiberCovaris520130Sonicator tube. Accessory of Focused-ultrasonicator
Focused-ultrasonicatorCovarisS220 or E220To digest DNA into adequate size for ChIP-Seq
UltraPure 10% SDSThermo Fisher Scientific15553-027For ChIP Elution Buffer
RNase ANacalai Tesque30141-14To purify DNA from lysate
Proteinase K, recombinant, PCR GradeSigma-Aldrich3115887001To purify DNA from lysate
EthanolWako Pure Chemical Industries, Ltd.054-07225Make 70% solution
Monoclonal anti-FLAG M2 antibody produced in mouseSigma-AldrichF1804To purify chromatin expressed in cells of interest
Dynabead M-280 Sheep Anti-Mouse IgGThermo Fisher Scientific11201DThis can be used for anti-FLAG IP and anti-H3K4me3 IP
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibodyWako Pure Chemical Industries, Ltd.301-34811Any other antibody that works for ChIP analysis will work
10x Blocking ReagentSigma-Aldrich11096176001For blocking during affinity purification
Denhardt’s solutionNacalai Tesque10727-74For blocking during affinity purification
Glycogen (5 mg/ml)Thermo Fisher ScientificAM9510To purify DNA from lysate
Qubit 2.0 FluorometerThermo Fisher ScientificQ32866For quantification of isolated DNA
Qubit dsDNA HS Assay KitThermo Fisher ScientificQ32851For quantification of isolated DNA
0.5 mL tubeAxygen10011-830For quantification by Qubit
Phenol/chloroform/isoamyl alcohol (25:24:1)Nacalai Tesque25970-56To purify DNA from lysate
AMPure XP beadsBeckman CoulterA63881SPRI magnetic beads for library preparation
Metal ice rackFunakoshiIR-1To keep the cell lysate frozen
Sample CoolerNew England BiolabsT7771SHelps fix cells with minimal damage
2100 BioanalyzerAgilent TechnologiesG2939BATo check the quality of isolated DNA fragments. Another fragment analyzer can be used.
Bioanalyzer 2100 Expert SoftwareAgilent TechnologiesG2946CASupplied with the Bioanalyzer
High Sensitivity DNA KitAgilent Technologies5067-4626To check the quality of the isolated DNA fragments
KAPA LTP Library Preparation KitRoche07961898001Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution
NEXTflex DNA BarcodesBIOO ScientificNOVA-514101Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.
KAPA Real-Time Library Amplification KitRoche07959028001Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards
2x KAPA HiFi HotStart ReadyMixRocheKM2602For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit
Buffer EBQiagen1908610 mM Tris-Cl, pH 8.5 for elution of DNA
386-well qPCR plateThermo Fisher Scientific4309849For real-time PCR
QuantStudio 7 Flex Real-Time PCR SystemThermo Fisher Scientific4485701To quantify DNA
MicroAmp Optical Adhesive FilmThermo Fisher Scientific4311971For real-time PCR
MicroAmp Clear Adhesive FilmThermo Fisher Scientific4306311For plate sealing
End-repair master mixCombine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O
A-taling master mixCombine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O
Ligation buffer mixCombine 2 µL of KAPA ligation buffer and 6 µL of H2O
Real-time PCR master mixCombine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O
PCR master mixCombine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O
Integrative Genomics ViewerBroad InstituteIGV_2.3.88Genome browser to visualize sequencing data
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′Eurofins GenomicsA primer to amplify the promoter region of GAPDH
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′Eurofins GenomicsA primer to amplify the promoter region of GAPDH
SYBR Premix Ex TaqTakaraRR420LTo quantify the DNA corresponding to the GADPH promoter region
Thermal Cycler DiceTakaraTP870To quantify the DNA corresponding to the GADPH promoter region

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Mito, M., et al. Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing. Scientific Reports. 8 (1), 1143(2018).
  2. Kadota, M., et al. CTCF binding landscape i....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

TChIP SeqChromatin ImmunoprecipitationHistone ModificationCell Type SpecificEpigenome ProfilingTissue DissectionCryogenic GrindingFormaldehyde FixationSonication ChromatinAffinity Purification

Related Articles