A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

7.4K views

DOI:

10.3791/58298

January 23rd, 2019

In This Article

Summary

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Abstract

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Introduction

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.

To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq — chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA — we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.

Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.

Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

Access restricted. Please log in or start a trial to view this content.

Protocol

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.

1. Tissue dissection

  1. Dissect the tissues of interest into small pieces (approximately <3 mm2) using fine spring scissors.
    Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.
  2. Add the dissected tissue fragments to a clean container filled with liquid nitrogen and collect them into 2 mL tubes (1 piece per tube) filled with liquid nitrogen.
    Note: Tubes with a hydrophilic surface are recommended for this step.
  3. Place the tubes at -80 °C for > 5 min with the cap open to evaporate the remaining liquid nitrogen.
    Note: After closing the cap, tissue fragments can be stored at -80 °C for one month before use.

2. Cell fixation

Note: We used a handy cryogenic grinder for this step. An alternative apparatus can be used.

  1. Place the 2 mL-protein low binding tubes containing the tissue samples on a metal ice rack chilled in liquid nitrogen.
  2. Place a metal bullet in a 1.5 mL-tube and chill with liquid nitrogen. Place it on the metal ice rack.
  3. Open the 2 mL-tube and place the prechilled metal bullet into the tube. Close the cap, set the 2 mL-tubes into the tube holder of a handy cryogenic grinder, and immediately dip the assembled tube holder in liquid nitrogen for 1 min.
  4. Insert the frozen tube holder into the outer cassette of the handy cryogenic grinder and shake vigorously 60 times for 30 s.
  5. Disassemble the tube holder, remove the metal bullet, and place the 2 mL-tube on a sample cooler prechilled at -20 °C.
  6. Place the sample cooler at -20 °C for 15 min to prevent freezing of the fixative in the next step.
  7. Bring the sample cooler to the bench, open the lid of the tube, and immediately drip 900 µL of 1% formaldehyde into it. After pipetting several times, transfer the suspension into new 2 mL-tube containing 900 µL of 1% formaldehyde and fix for 10 min with gentle rotation in an incubator set at 23 °C.
    CAUTION: Formaldehyde is toxic and harmful.
  8. To stop the fixation reaction, add 100 µL of 2.5 M glycine to each tube and centrifuge for 5 min at 3,000 x g at 4 °C. Discard the supernatant.
  9. Add 1 mL of ice-cold phosphate-buffered saline (PBS), centrifuge for 5 min at 3,000 x g at 4 °C, and discard the supernatant. Repeat this step twice (3 washes in total).
    Note: Fixed samples can be flash-frozen by liquid nitrogen and stored at -80 °C.
  10. Add 500 µL of Lysis Buffer 1 (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 7.5), 140 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 10% w/v glycerol, 0.5% w/v NP-40, 0.25% w/v Triton X-100, and 0.1x protease inhibitor cocktail) to the pellet, pipet several times, and rotate for 10 min at 4 °C.
    NOTE: Lysis Buffer 1 should be filtered and stored at 4 °C before use.
  11. Centrifuge for 5 min at 3,000 x g at 4 °C and discard the supernatant.
  12. Add 1 mL of Lysis Buffer 2 (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA (pH 8.0), 0.5 mM EGTA, and 0.1x protease inhibitor cocktail) to the pellet, vortex, and rotate for 10 min at 4 °C.
    NOTE: Lysis Buffer 2 should be filtered and stored at 4 °C before use.
  13. Centrifuge for 5 min at 3,000 x g at 4 °C and discard the supernatant.
  14. Add 800 µL of radioimmunoprecipitation assay (RIPA) buffer with 1x protease inhibitor cocktail to the pellet and resuspend the pellet by pipetting.
  15. Centrifuge for 5 min at 3,000 x g at 4 °C and discard the supernatant.
  16. Add 500 µL of RIPA buffer with 1x protease inhibitor cocktail.
  17. Centrifuge for 5 min at 3,000 x g at 4 °C and discard the supernatant.
  18. Add 1 mL of RIPA buffer with 1x protease inhibitor cocktail. Immediately proceed to the next step.

3. Chromatin Shearing

  1. Transfer the lysate to a sonicator tube and then place the tube on an ultrasonicator.
  2. Shear the chromatin with the following settings: temperature: 4 °C; peak incident power: 175 W; duty factor: 10%; cycles/burst: 200; and time: 2,400 s.
  3. Transfer the sample to a 1.5 mL-protein low binding tube and centrifuge for 5 min at 20,000 x g at 4 °C.
  4. Collect the supernatant into a new protein low binding tube.
    Note: The sample can be flash-frozen in liquid nitrogen and stored at -80 °C.

4. Quality check of DNA (Reverse Crosslinking)

  1. Mix 20 µL of the lysate and 180 µL of ChIP Elution Buffer (10 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5 mM EDTA (pH 8.0), and 1% w/v sodium dodecyl sulfate (SDS)) in a polymerase chain reaction (PCR) tube. Incubate the sample at 65 °C in a thermal cycler for 6 h with the thermal cycler lid open. Keep the lid of the thermal cycler open to avoid over-denaturation.
    Note: The ChIP Elution Buffer should be filtered and stored at room temperature before use. This incubation can be extended to overnight.
  2. Add 1 µL of 10 mg/mL RNase A, vortex, and incubate at 37 °C for 30 min.
  3. Add 6.5 µL of 15 mg/mL proteinase K, vortex, and incubate at 55 °C for 60 min.
  4. Transfer the reaction to a DNA low binding tube, add 4 µL of 5 mg/mL glycogen, and vortex. Then, add 200 µL of phenol/chloroform/isoamyl alcohol (25:24:1) and centrifuge for 5 min at 18,000 x g at room temperature.
  5. Transfer the supernatant to a new DNA low binding tube. Add 200 µL of Tris-EDTA-NaCl buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), and 200 mM NaCl) to the remaining phenol/chloroform/isoamyl alcohol solution and centrifuge for 5 min at 18,000 x g at room temperature. Collect the supernatant and mix with the first supernatant.
  6. Add 900 µL of ice-cold ethanol and incubate for 1 h at -20 °C.
    Note: This incubation can be extended to 4- 6 h.
  7. Centrifuge for 30 min at 18,000 x g at 4 °C.
  8. Discard the supernatant. Add 1 mL of ice-cold 75% ethanol to the pellet and centrifuge for 30 min at 18,000 x g at 4 °C. Repeat this step (two washes in total).
  9. Discard the supernatant thoroughly and air-dry for 1 min at room temperature.
  10. Add 50 µL of Tris-EDTA (TE) buffer and dissolve the DNA by incubating it at room temperature for 30 min or at 4 °C overnight. Avoid vortexing or pipetting. Keep this DNA as “input” and use it for library preparation if necessary.
  11. Measure the DNA concentration with a fluorometer according to the manufacturer’s instruction (see Table of Materials) and check the size distribution with a microfluidic electrophoresis machine (see representative data shown in Figure 2A). Use 10 ng or less DNA for this assay.
    Note: Fragments of 100–500 base pairs (bp) should make up 50% or more of the DNA.

5. Affinity purification by anti-FLAG antibody

Note: For neuron tChIP-Seq, brain tissues from 8 mice are typically used for one sample of tChIP-Seq to prepare 2 ng of purified DNA by tandem immune-purification (see Step 7.1). In our hands, 0.1 ng of DNA still provided high-quality DNA libraries for ChIP-Seq (Kadota, unpublished). Thus, in theory, a single mouse may be sufficient to perform neuron tChIP-Seq. The required amount should be optimized for the tissue and cell type of interest. For the negative control of the imumuno-purification experiment, brain tissue lysate from mice without any H2B-FLAG expression should be prepared and used.

  1. Pipette 200 µL of the magnetic beads conjugated to sheep anti-mouse immunoglobulin G (IgG) into a protein low binding tube.
  2. Place the tube onto a magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and vortex. Repeat this step (two washes in total).
  3. Add 20 µL of 1 mg/mL anti-FLAG antibody and rotate for 5 h at 4 °C.
    Note: This incubation can be extended to overnight.
  4. Wash the beads following Step 5.2. Place the beads into a 15-mL tube.
  5. Resuspend the beads in 1110 µL of RIPA buffer and then add 900 µL of 10x blocking reagent, 180 µL of 50x Denhardt’s solution, 10 µL of 100x protease inhibitor cocktail, and 6.8 mL of the lysate prepared in Step 3. Split this mixture into 5 protein low binding tubes. Rotate for 6 h at 4 °C.
    Note: This incubation can be extended to overnight.
  6. Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 5 times (6 washes in total). Pool all the beads into a single protein low binding tube.
  7. Add 200 µL of ChIP Elution Buffer and rotate for 15 min at room temperature. Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2B and C). Immediately proceed to the next step.

6. Affinity Purification by Anti-H3K4me3 Antibody and Reverse Crosslinking

Note: The following bead preparation Steps (6.1–6.4) should be performed before Step 5.7.

  1. Pipette 40 µL of magnetic beads conjugated to sheep anti-mouse IgG into a 2 mL-protein low binding tube.
  2. Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and gently mix. Repeat this step (two washes in total).
  3. Add 4 µL of 1 mg/mL anti-H3K4me3 antibody and rotate for 6 h at 4 °C.
  4. Wash the beads following Step 6.2. Place the beads into a 2 mL-protein low binding tube.
  5. Resuspend the beads in 1558 µL of RIPA buffer and then add 200 µL of 10x blocking reagent, 40 µL of 50x Denhardt’s solution, 2 µL of 100x protease inhibitor cocktail, and 200 µL of the eluate prepared in Step 5.7. Rotate overnight at 4 °C.
    Note: The SDS in the ChIP elution buffer was diluted more than 10 times in this incubation.
  6. Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 4 times (5 washes in total). After the last wash, transfer the beads into a DNA low binding tube, and discard the supernatant.
  7. Add 200 µL of ChIP Elution Buffer and rotate for 15 min at room temperature. Transfer the eluate to a new DNA low bindingTube.
    Note: The eluate can be stored at -80 °C.
  8. Follow Step 4 for decrosslinking of the DNA. Resuspend the purified DNA in 20 µL of TE buffer.
  9. Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2D). (optional) Perform enrichment analysis by quantitative PCR as described previously2. Ten-fold or greater enrichment should be observed.

7. Library Construction

  1. For each input and ChIP DNA sample, calculate the proportion of DNA in the 100–500-bp region using the smear analysis function of the software for the microfluidic electrophoresis machine. Estimate the sample volume required to obtain 2 ng of 100–500 bp DNA. Use 20 ng DNA in the 100–500-bp range as the “input” sample.
  2. Pipette DNA samples into 8-strip PCR tubes and add H2O to bring the total volume to 10 µL. (optional) If the volume of DNA exceeds 10 µL, proportionally scale-up the following end-repair reaction and the size selection.
  3. Prepare end-repair master mix (see Table of Materials). Add 4 µL of end-repair master mix to the DNA and incubate for 30 min at 20 °C.
  4. Add 36 µL of 10 mM Tris-Cl, pH 8.5 and 0.6x volume (30 µL) of solid phase reversible immobilization (SPRI) magnetic beads and incubate for 5 min at room temperature.
  5. Place the tube on a magnetic stand and wait until the supernatant becomes clear.
  6. Transfer the supernatant to a new tube, add 1.2x volumes (60 µL) of SPRI magnetic beads, and incubate 5 min at room temperature.
  7. Place the tube on a magnetic stand and wait until the supernatant becomes clear.
  8. Wash the beads twice with 200 µL of 80% EtOH, holding the tube still on the magnet.
  9. Briefly centrifuge the tube to collect the residual EtOH at the bottom and place it back on the magnet. Remove the residual EtOH thoroughly.
  10. Leave the tube lid open for 1-2 min to allow the EtOH to evaporate.
  11. Close the lid and keep the tube on ice.
    Note: Now you have obtained size-selected DNA of 100–500 bp on the beads. Further details about double size selection can be found on the manufacturer’s website (www.beckman.com).
  12. Prepare A-tailing master mix (see Table of Materials).
  13. Resuspend the beads (from Step 7.10) with 10 µL of A-tailing master mix and incubate for 30 min at 30 °C.
  14. Add 1.8x volume (18 µL) of polyethylene glycol (PEG)/NaCl solution and incubate for 5 min at room temperature.
  15. Follow Steps 7.7-7.11 to purify the DNA.
  16. Prepare ligation buffer mix (see Table of Materials).
  17. Pipette 8 µL of ligation buffer mix onto the beads (from Step 7.14), add 1 µL of 1 µM adapter, and resuspend the beads. Use 1 µL of 5 µM adapter for the input sample. Consider using different adapters for each sample for multiplexing.
  18. Add 1 µL of DNA Ligase and incubate for 15 min at 20 °C.
  19. Add 1.0x volume (10 µL) of PEG/NaCl solution, resuspend the beads, and incubate for 5 min at room temperature.
  20. Follow Steps 7.7-7.10 to purify the DNA.
  21. Pipette 25 µL of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.
  22. Add 1.0x volume (25 µL) of PEG/NaCl solution and incubate for 5 min at room temperature.
  23. Follow Steps 7.7-7.10 to purify the DNA.
  24. Pipette 11 µL of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.
  25. Place the tube on a magnetic stand and wait until the supernatant becomes clear.
  26. Collect the supernatant into a new 8-strip PCR tube.
  27. Prepare real-time PCR master mix (see Materials for details).
  28. Pipette 8.5 µL of real-time PCR master mix in a 384-well quantitative PCR (qPCR) plate and add 1.5 µL of the adapter ligated DNA (from Step 7.26).
  29. Pipette 10 µL of each fluorescent standard in empty wells.
  30. Perform real-time PCR with the following programm: (98 °C for 45 s) x 1 cycle, (98 °C for 15 s, 60 °C for 30 s, 72 °C for 30 s) x 20 cycles, and (72 °C for 60 s) x 1 cycle.
  31. Determine the number of PCR cycles needed to reach the fluorescence intensity of the Fluorescent Standard 2.
  32. Prepare the PCR master mix (see Table of Materials).
  33. Pipette 11.5 µL of the PCR master mix into the remaining adapter-ligated DNA (from Step 7.26) and perform PCR as indicated in Step 7.30 with the PCR cycles determined in Step 7.31.
  34. Add 1.0x volume (20 µL) of PEG/NaCl solution and incubate for 5 min at room temperature.
  35. Follow Steps 7.7-7.10 to purify the DNA.
  36. Pipette 20 µL of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.
  37. Place the tube on a magnetic stand and wait until the supernatant becomes clear.
  38. Collect the supernatant into a new 1.5 mL-DNA low binding tube.
  39. Check the quality of the library as described in Step 4.11 (see representative data shown in Figure 2E and F). Use 1 µL of the library DNA sample. (optional) Perform enrichment analysis by qPCR as described previously 2. Ten-fold or greater enrichment should be observed.

8. Sequencing

  1. Sequence the libraries in a next-generation sequencer (see representative data shown in Figure 3).
    Note: The sequence depth sufficient for the data analysis will vary depending on the genome size of the organism3. For human and mouse, we recommend obtaining at least 20-40 million single-end reads. According to the yield of reads, multiplexing might be cost effective.

Access restricted. Please log in or start a trial to view this content.

Results

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...

Access restricted. Please log in or start a trial to view this content.

Discussion

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.

A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects "Cellular Evolution" and all RIKEN project "Disease and Epigenome" from RIKEN (to S.N. and S.I.).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Protein LoBind tube, 2 mLEppendorfNo. 0030108132For cell lysis
Protein LoBind tube, 1.5 mLEppendorfNo. 0030108116For ChIP and library preparation
DNA LoBind tube, 1.5 mLEppendorfNo. 0030108051For ChIP and library preparation
8-strip PCR tubeBIO-BIK3247-00For ChIP and library preparation
SK MillTOKKENSK-200Handy cryogenic grinder to make cell powder for fixation
Metal bulletTOKKENSK-100-DLC10Accessory of SK Mill
2 mL stainless steel tubeTOKKENTK-AM5-SUSAn option for cell lysis
2 mL stainless steel tube holderTOKKENSK-100-TLAn option for cell lysis
16% formaldehyde (w/v), methanol-freePierce28906To fix cells. Prepare 1% solution before use.
GlycineNacalai Tesque17109-35Prepare 2.5 M stock
D-PBS (-)(1x)Nacalai Tesque14249-24For washing lysate and purified DNA
HEPESNacalai Tesque02443-05For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.
5 M NaCl, molecular biology gradeNacalai Tesque06900-14For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
0.5 M EDTA, molecular biology gradeWako Pure Chemical Industries, Ltd.311-90075For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
GlycerolWako Pure Chemical Industries, Ltd.072-04945For lysis buffer 1
NP-40Nacalai Tesque25223-75For lysis buffer 1
Triton X-100, molecular biology gradeNacalai Tesque12967-32For Lysis buffer 1
TrisNacalai Tesque35406-91For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.
0.1 M EGTA pH neutralNacalai Tesque08947-35For Lysis Buffer 2
Protease inhibitor cocktail (100x)Nacalai Tesque25955-24To block degradation of protein
RIPA bufferThermo Fisher Scientific89900For cell lysis and washing
milliTUBE 1 mL AFA FiberCovaris520130Sonicator tube. Accessory of Focused-ultrasonicator
Focused-ultrasonicatorCovarisS220 or E220To digest DNA into adequate size for ChIP-Seq
UltraPure 10% SDSThermo Fisher Scientific15553-027For ChIP Elution Buffer
RNase ANacalai Tesque30141-14To purify DNA from lysate
Proteinase K, recombinant, PCR GradeSigma-Aldrich3115887001To purify DNA from lysate
EthanolWako Pure Chemical Industries, Ltd.054-07225Make 70% solution
Monoclonal anti-FLAG M2 antibody produced in mouseSigma-AldrichF1804To purify chromatin expressed in cells of interest
Dynabead M-280 Sheep Anti-Mouse IgGThermo Fisher Scientific11201DThis can be used for anti-FLAG IP and anti-H3K4me3 IP
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibodyWako Pure Chemical Industries, Ltd.301-34811Any other antibody that works for ChIP analysis will work
10x Blocking ReagentSigma-Aldrich11096176001For blocking during affinity purification
Denhardt’s solutionNacalai Tesque10727-74For blocking during affinity purification
Glycogen (5 mg/ml)Thermo Fisher ScientificAM9510To purify DNA from lysate
Qubit 2.0 FluorometerThermo Fisher ScientificQ32866For quantification of isolated DNA
Qubit dsDNA HS Assay KitThermo Fisher ScientificQ32851For quantification of isolated DNA
0.5 mL tubeAxygen10011-830For quantification by Qubit
Phenol/chloroform/isoamyl alcohol (25:24:1)Nacalai Tesque25970-56To purify DNA from lysate
AMPure XP beadsBeckman CoulterA63881SPRI magnetic beads for library preparation
Metal ice rackFunakoshiIR-1To keep the cell lysate frozen
Sample CoolerNew England BiolabsT7771SHelps fix cells with minimal damage
2100 BioanalyzerAgilent TechnologiesG2939BATo check the quality of isolated DNA fragments. Another fragment analyzer can be used.
Bioanalyzer 2100 Expert SoftwareAgilent TechnologiesG2946CASupplied with the Bioanalyzer
High Sensitivity DNA KitAgilent Technologies5067-4626To check the quality of the isolated DNA fragments
KAPA LTP Library Preparation KitRoche07961898001Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution
NEXTflex DNA BarcodesBIOO ScientificNOVA-514101Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.
KAPA Real-Time Library Amplification KitRoche07959028001Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards
2x KAPA HiFi HotStart ReadyMixRocheKM2602For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit
Buffer EBQiagen1908610 mM Tris-Cl, pH 8.5 for elution of DNA
386-well qPCR plateThermo Fisher Scientific4309849For real-time PCR
QuantStudio 7 Flex Real-Time PCR SystemThermo Fisher Scientific4485701To quantify DNA
MicroAmp Optical Adhesive FilmThermo Fisher Scientific4311971For real-time PCR
MicroAmp Clear Adhesive FilmThermo Fisher Scientific4306311For plate sealing
End-repair master mixCombine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O
A-taling master mixCombine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O
Ligation buffer mixCombine 2 µL of KAPA ligation buffer and 6 µL of H2O
Real-time PCR master mixCombine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O
PCR master mixCombine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O
Integrative Genomics ViewerBroad InstituteIGV_2.3.88Genome browser to visualize sequencing data
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′Eurofins GenomicsA primer to amplify the promoter region of GAPDH
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′Eurofins GenomicsA primer to amplify the promoter region of GAPDH
SYBR Premix Ex TaqTakaraRR420LTo quantify the DNA corresponding to the GADPH promoter region
Thermal Cycler DiceTakaraTP870To quantify the DNA corresponding to the GADPH promoter region

References

  1. Mito, M., et al. Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing. Scientific Reports. 8 (1), 1143(2018).
  2. Kadota, M., et al. CTCF binding landscape in jawless fish with reference to Hox cluster evolution. Scientific Reports. 7 (1), 4957(2017).
  3. Jung, Y. L., et al. Impact of sequencing depth in ChIP-seq experiments. Nucleic Acids Research. 42 (9), (2014).
  4. Becker, P. B., Workman, J. L. Nucleosome remodeling and epigenetics. Cold Spring Harbor Perspectives in Biology. 5 (9), a017905(2013).
  5. Kidder, B. L., Zhao, K. Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells. Methods in Molecular Biology. , 3-20 (2014).
  6. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645(2012).
  7. Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nature Methods. 12 (10), 963-965 (2015).
  8. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34 (36), 11929-11947 (2014).
  9. Hornstein, N., et al. Ligation-free ribosome profiling of cell type-specific translation in the brain. Genome Biology. 17 (1), 149(2016).
  10. Zhao, Y., Garcia, B. A. Comprehensive catalog of currently documented histone modifications. Cold Spring Harbor Perspectives in Biology. 7 (9), a025064(2015).
  11. Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. Formaldehyde crosslinking: a tool for the study of chromatin complexes. The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Chromatin ImmunoprecipitationHistone ModificationTissue DissectionCryogenic GrindingFormaldehyde FixationSonication ChromatinAffinity Purification