We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.
Method Article
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
| Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
| DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
| 8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
| SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
| Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
| 2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
| 2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
| 16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
| Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
| D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
| HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
| 5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| 0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
| NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
| Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
| Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
| 0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
| Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
| RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
| milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
| Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
| UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
| RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
| Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
| Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
| Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
| Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
| Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
| 10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
| Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
| Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
| Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
| Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
| 0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
| Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
| AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
| Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
| Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
| 2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
| Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
| High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
| KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
| NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
| KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
| 2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
| Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
| 386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
| QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
| MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
| MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
| End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
| A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
| Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
| Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
| PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
| Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
| DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
| Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission