A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula

12.8K views

DOI:

10.3791/58544

January 7th, 2019

In This Article

Summary

Agrobacterium-mediated transformation using a floral-dip method can be successfully employed to create stable transgenic lines of the extremophyte model Schrenkiella parvula. We present a protocol modified from that for Arabidopsis thaliana, considering different growth habits and physiological characteristics of the extremophyte.

Abstract

Schrenkiella parvula is an extremophyte adapted to various abiotic stresses, including multiple ion toxicity stresses. Despite high-quality genomic resources available to study how plants adapt to environmental stresses, its value as a functional genomics model and tool has been limited by the lack of a feasible transformation system. In this protocol, we report how to generate stable transgenic S. parvula lines using an Agrobacterium-mediated floral-dip method. We modified the transformation protocol used for A. thaliana to account for unique traits of S. parvula, such as an indeterminate flowering habit and a high epicuticular wax content on leaves. Briefly, S. parvula seeds were stratified at 4 °C for five days before planting. Plants were grown at a photoperiod of a 14 h light and 10 h dark and a 130 µmol m-2s-1 light intensity, at 22 °C to 24 °C. Eight to nine week-old plants with multiple inflorescences were selected for transformation. These inflorescences were dipped in an infiltration solution of Agrobacterium tumefaciens GV3101 carrying the pMP90RK plasmid. We performed two rounds of flower dipping with an interval of three to four weeks to increase the transformation efficiency. The T1 seeds were collected and dried for four weeks in a container with desiccants before germination to screen for candidate transformed lines. Resistance to BASTA was used to screen T1 plants. We sprayed the BASTA solution three times with an interval of three days starting at two week-old plants to reduce false positives. A BASTA drop test was performed on surviving individual plants to identify true positive transformants. The transformation efficiency was 0.033%, yielding 3–4 transgenic plants per 10,000 T1 seeds propagated.

Introduction

In this protocol, we describe the growth and establishment of stable transgenic lines for the extremophyte model Schrenkiella parvula. The availability of an efficient transformation system is a hallmark of any versatile genetic model. Plants that thrive in extreme environments, referred to as extremophytes, provide a critical resource for understanding plant adaptations to environmental stresses. Schrenkiella parvula (formerly Thellungiella parvula and Eutrema parvulum) is one such extremophyte model, with expanding genomic resources1,2,3,4,5. However, transformation protocols have not yet been reported for S. parvula in published studies.

The genome of S. parvula is the first published extremophyte genome in Brassicaceae (mustard-cabbage family) and shows an extensive overall genome synteny with the non-extremophyte model, Arabidopsis thaliana1. Thus, comparative studies between A. thaliana and S. parvula could benefit from the wealth of genetic studies performed on A. thaliana to make informative hypotheses on how the S. parvula genome has evolved and regulated differently to cope with extreme environmental stresses5,6,7. S. parvula is one of the most salt-tolerant species (based on soil NaCl LD50) among known wild relatives of A. thaliana8. In addition to the NaCl tolerance, S. parvula survives and completes its life cycle in the presence of multiple salt ions at high concentrations toxic to most plants7. In response to the abiotic stresses prevalent in its natural habitat, it has evolved various traits, among which several have been studied at the biochemical or physiological level 8,9,10,11.

Since 2010, there have been over 400 peer-reveiwed publications that used S. parvula as a target species or used it in a comparison with other plant genomes. However, a clear bottleneck could be identified with a closer look of what type of studies have been conducted. The majority of these reports discuss the potential use of S. parvula in future studies or use it in comparative genomic or phylogenomic studies. Due to the lack of a proof-of-concept transformation protocol established for S. parvula, it has not been used in functional genomic studies, despite having one of the highest quality plant genomes available to date (>5 Mb contig N50) assembled and annotated into chromosome-level pseudomolecules1.

The Agrobacterium-mediated floral-dip transformation method has become the most broadly used method to create trasngenic lines in A. thaliana, and the development of a reproducible system of transformation was a critical factor in its success as a genetic model12,13. However, not all Brassicaceae species have been shown to be successfully transformed using the floral-dip method developed for A. thaliana. Specially, the Brassicaceae Lineage II species that include S. parvula has been recalcitrant to floral-dip based transformation methods14,15.

The indeterminate flowering growth habit of S. parvula, combined with its narrow leaf morphology has made it challenging to adopt the standard Agrobacterium-mediated floral-dip transformation method. In this study, we report the modified protocol we have developed for reproducible transformation of S. parvula.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Plant Growth

  1. Seed sterilization (optional)
    1. Prepare 50% bleach in double-distilled water (ddH2O) with 1 or 2 drops of a non-ionic detergent (see Table of Materials) in a 50 mL tube. Invert the tube several times to mix the solution.
      NOTE: It is preferable to conduct seed sterilization in a laminar flow cabinet with a UV sterilized surface for 15 min.
    2. Add the bleach solution to ~100–200 S. parvula seeds in a 1.5 mL tube. Mix thoroughly and let the tube sit for 5 min.
    3. Remove the bleach from the tube and add 70% ethanol. Wash the seeds by pipetting several times and then remove the ethanol solution immediately.
    4. Wash the seeds in sterilized water to remove excess bleach and ethanol, then remove the water. Repeat this step 5 to 6 times.
  2. Seed stratification
    1. Immerse the seeds in sterilized water, and store for 5 to 7 days at 4 °C. Alternatively, sow dried unsterilized seeds directly on wet soil, and place the soil tray for 5 to 7 days at 4 °C.
  3. Growing plants in preparation of transformation
    1. Fill the soil mix (see Table of Materials) into 7 x 6 cm2 pots, soak the pots in water, and spray water from the top to ensure a uniformly wet growth medium. Add 5– fertilizer beads (see Table of Materials) on the soil surface of each pot.
      NOTE: As far as we have experienced, S. parvula grows well on any soil mix where A. thaliana can grow.
    2. Using a wet toothpick, transfer 20~25 seeds per pot on the soil surface.
      NOTE: A convenient practice is to put a batch of 4–5 seeds in the four corners and the center of the pot (Figure 1, Day 15, left panel).
    3. Cover the pot tray with a clear dome to keep the seeds under high humidity during germination.
    4. Keep the plant trays in a growth chamber with a light intensity set at 130 µmol m−2 s−1 light, 22–24 °C temperature, and 14 h per day/10 h per night cycle. Remove the domes after 7 - 10 days following germination. Add water from the bottom of the tray to keep soil moistened uniformly at a desirable level.
    5. Weed out extra seedlings and leave only 4–5 healthy seedlings per pot well separated from each other (Figure 1, Day 15, right panel).
    6. Gently water the plants every two days and fertilize with 0.2x Hoagland's solution16 once every two weeks.
      NOTE: Keeping the soil moisture at a uniform level is key to growing S. parvula consistently and healthily.
    7. Continue to grow the plants for 8–10 weeks until multiple inflorescences produce 100–150 floral buds per plant (Figure 1, Day 60–80). On the day planned for the floral-dip based transformation (step 4.5), remove all mature and developing siliques from the plants.

2. Cloning the Gene/Genomic Element of Interest into a Vector for Plant Transformation

  1. Amplify the target DNA fragment using polymerase chain reaction (PCR)17 and isolate the PCR product using a gel extraction kit (see Table of Materials) according to the kit protocol or any other appropriate method to purify DNA using agarose gel electrophoresis17,18. Verify the sequence of the isolated PCR product through Sanger sequencing19.
  2. Clone the desired PCR product into the cloning vector and transform the cloned construct into the competent E. coli cells using a topoisomerase-based cloning kit (see Table of Materials) following manufacturer's guidelines.
  3. Spread 50 µL of transformed products on Luria-Bertani20 (LB) agar bacterial growth media (Table 1) with appropriate antibiotics, e.g., 50 µg/ mL Spectinomycin (see Table of Materials), and incubate at 37 °C overnight.
  4. The following day, select 5–10 single colonies, inoculate into liquid LB medium with appropriate antibiotics, and incubate with gentle shaking at 37 °C overnight.
  5. Isolate plasmids using a plasmid isolation kit (see Table of Materials) and verify through Sanger sequencing19 whether the target sequence amplified in 2.1 is properly cloned.
  6. Transfer the cloned and verified PCR product to a destination vector for plant transformation compatible with recombination-based cloning (see Table of Materials), using a recombinase enzyme mix kit (see Table of Materials), following the kit manufacturer's instruction. Repeat from step 2.3 to step 2.5 to isolate and verify clones harboring proper plasmid constructs.

3. Transforming the Vector Construct for Plant Transformation into Agrobacterium tumefaciens

  1. Transform the plasmid of the vector construct from 2.6 into the A. tumefaciens strain GV3101:pMP90RK21, which harbors a Rifampicin resistance gene for chromosomal background selection. Use appropriate antibiotics, e.g. Gentamycin or Kanamycin (see Table of Materials), for the selection of plant transformation construct (Ti plasmid). A brief protocol for A. tumefaciens transformation via electroporation is included in section 3.2.
  2. A. tumefaciens transformation by electroporation
    1. Thaw the A. tumefaciens competent cells22 on ice. Mix 0.1–1 µg of the plasmid prepared from 2.6, dissolved in 1–2 µL of ddH2O, with competent cells on ice. Transfer the mixture into an electroporation cuvette (see Table of Materials).
    2. Perform electroporation on the mixture of plasmids and competent cells from 3.2.1, using an electroporator (see Table of Materials) following the manufacturer's guidelines.
      NOTE: Clean the surface of the cuvette before starting the electroporation.
    3. Transfer the reaction mixture from the cuvette to a microcentrifuge tube that contains 1.5 mL of liquid LB and mix well with pipetting and incubate for 1 h at 28 °C with gentle shaking.
  3. Inoculate the transformed A. tumefaciens from section 3.2 on LB plates containing appropriate selection antibiotics (e.g. Kanamycin 25 µg/ mL, Spectinomycin 50 µg/ mL, Gentamycin 25 µg/ mL, and Rifampicin 50 µg/ mL) and incubate at 28 °C for 3 days.

4. Agrobacterium-mediated Transformation of S. parvula

  1. Inoculate the single transformed colonies from plates into 10 mL of LB liquid media containing antibiotics (the same as in 3.3) in a sterile 50 mL conical tube (see Table of Materials). Incubate for 24 h in a shaking incubator (see Table of Materials) at 250 r.p.m. at 28 °C.
  2. Transfer the bacterial solution from 3.4.1 to a sterile 250 mL flask, add 40 mL of LB liquid media with appropriate antibiotics, and incubate 12 h until the optical density at 600 nm wavelength (OD600) reaches around 2.0.
  3. Centrifuge the A. tumefaciens cultureat 3,100 x g for 10 min. Remove the supernatant and re-suspend the bacterial culture in 40 mL of A. tumefaciens infiltration solution (Table 1).
  4. Dilute the resuspended A. tumefaciens with infiltration solution to a final OD600 of 0.8. Add 25 µL of surfactant solution (Table 1) to 50 mL of diluted A. tumefaciens solution and mix by inverting several times.
  5. Dip the inflorescence of the plants in the A. tumefaciens solution prepared in the section 4.4 for 20 s. Use a fresh bacterial solution after dipping inflorescence from six pots. Make sure all flowers are in contact with the solution. Pipet bacterial solutions directly onto flowers located in the lower part of the inflorescence if they cannot be dipped into the solution.
    NOTE: For the first-round transformation, make sure to remove all mature and developing siliques using a sharp scalpel or small scissors. Do not remove siliques if performing transformation for the second time.

5. Post-transformation Plant Care and the Second Transformation

  1. Place the floral-dipped plants horizontally in clean trays with domes to cover the plants and place in a dark growth room for 1–2 days.
    NOTE: Keeping the flowers under high-humidity is important at this stage (Figure 1, Plants after transformation).
  2. Return the plants to an upright position and transfer the plants to a growth room with a 14 h per day/10 h per night cycle, 130 µmol m-2 s-1 light intensity and 22 to 24 °C temperature.
  3. Monitor the dipped inflorescences in the following week. If a significant number of flowers abort (Figure 2), repeat the floral dip (step 4) after about 4 weeks or after a large number of flowers have newly developed.
    NOTE: Unlike the preparation step for the first transformation (step 1.3.7), do not remove pre-existing or developing siliques (Figure 2) before the second round of transformation.
  4. Grow the plants until seeds mature and harvest seeds at ~21 weeks.
  5. Dry seeds for 2–3 weeks at room temperature in an airtight container with filled with desiccants (see Table of Materials).

6. Selection of Positive Transformants

  1. Plant the T1 seeds as described for wild type seeds in steps 1.2 to 1.3.
  2. Grow the plants until the first 2 true leaves develop, approximately 10–14 days after germination.
  3. Perform the first selection for herbicide resistance (Figure 3A and 3B) as detailed below.
    1. Dilute the glufosinate-ammonium (11.3%) herbicide (or BASTA) (Table 1) to 1:1,000 (v/v). Spray diluted BASTA solution on the seedlings and cover the plants with domes overnight.
    2. Repeat BASTA spraying 2–3 times every 5–7 days.
  4. Perform the second selection using a BASTA-drop test as detailed below.
    1. Identify plants that survive after being sprayed 3–4 times with BASTA solution. Grow the plants for another 2–3 weeks until 3–5 leaves develop a relatively large surface area.
    2. Select the largest mature leaf per plant, rub the surface of the leaf gently with a finger to remove the wax layer, and place a drop of the diluted BASTA solution (from step 6.3.1).
      NOTE: Mark the location of the leaf applied with the BASTA drop by placing a paper tape on the nearest stem.
    3. Monitor the leaves applied with the BASTA drop for signs of wilting for up to one week. Select the plants with leaves unaffected by the BASTA drops.
      NOTE: Leaves from most false-positive plants start to wilt within two days, while leaves from true-positives are intact even after the drop of BASTA solution dries up (Figure 3C).
  5. Confirm positive transformants using genomic PCR.
    1. Collect 2–3 leaves from the surviving plants at step 6.4.5.
    2. Extract genomic DNA from the leaves using the CTAB method23 or any other appropriate DNA extraction method.
    3. Perform PCR using extracted genomic DNA samples from target plants, wild-type plants (as negative controls), and the plasmid construct from the step 3.1 (as a positive control). Use an appropriate pair of PCR primers specific to the selective marker gene, e.g., for BASTA-resistant gene (bar), TCAGCAGGTGGGTGTAGA (forward) and GTCAACCACTACATCGAGACAA (reverse).
      1. For the example PCR primers targeting the bar gene, use the following PCR conditions: the initial denaturation step at 98 °C for 30 s; followed by 30 cycles of denaturing at 98 °C for 30 s, annealing at 59 °C for 30 s, and extending at 72 °C for 30 s; and the final extension at 72 °C for 5 min.
        NOTE: To ensure the insertion of the entire T-DNA, we recommend also performing genomic PCR using a PCR primer from the selective marker gene and another PCR primer specific to the target sequence cloned to the plant transformation vector at the step
    4. Confirm the presence of the expected size of the amplified bar PCR product by agarose gel electrophoresis17 for the target samples (Figure 4A) as well as by sequencing the isolated PCR product19 using the same procedure as in step 2.1.

Access restricted. Please log in or start a trial to view this content.

Results

We developed a transformation protocol that enables harvesting of T0 seeds within 150 days, using a floral-dip method modified from that for A. thaliana. Figure 1 shows a summary of the timeline and S. parvula plants that represent the optimal stage for executing the transformation through floral-dip. We selected S. parvula plants with 70 –80 flowers in multiple inflorescences at 60–80 days after germination as the target...

Access restricted. Please log in or start a trial to view this content.

Discussion

The physiological state of the plant significantly influences the efficiency of transformation25. The use of healthy and vigorous plants for transformation is a key requirement for successful transformation in S. parvula. Water or light stressed plants will have fewer flowers compared to the healthy plants ideal for transformation (Figure 1, center panel). S. parvula can grow at a light intensity less than 130 µmol m-2 s-1,...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by a National Science Foundation award MCB 1616827.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
AgarVWR International, Radnor, PA90000-762Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitaminsSigma-Aldrich, St. Louis, MOG1019Gamborg’s Vitamin Solution
DesiccantW A Hammond Drierite, Xenia, OH22005Indicating DRIERITE 6 mesh
Destination vector for plant transformationTAIRVector:6531113857pKGWFS7
Electroporation cuvetteUSA Scientific9104-5050Electroporation cuvette, round cap, 0.2 cm gap
ElectroporatorBIO-RAD Laboratories, Hercules, CA1652100MicroPulser Electroporator
Fertilizer beadsOsmocote Garden, Marysville, OHN/AOsmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kitiNtRON Biotechnology, Boston, MA17289MEGAquick-spin Total fragment DNA purification kit
GentamicinSigma-Aldrich, St. Louis, MOG1914-5GGentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA)Bayer environmental science, Montvale, NJN/AFINALE herbicide
KanamycinVWR International, Radnor, PA200004-444Kanamycin monosulfate
MESBioworld, Dublin, OH41320024-2MES, Free Acid
MS saltMP Biomedicals, Santa Anna, CA092621822Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA) Sigma-Aldrich, St. Louis, MOB32746-Benzylaminopurine solution
NaClSigma-AlrichS7653Sodium chloride
Non-ionic detergentSigma-Aldrich, St. Louis, MO9005-64-5TWEEN 20 
Plasmid isolation kitZymo Research, Irvine, CAD4036Zyppy Plasmid Kits
Recombinase enzyme mix kitLife Technology11791-020Gateway LR Clonase II Enzyme mix
RifampicinSigma-Aldrich, St. Louis, MOR3501-1GRifampicin, powder, ≥ 97% (HPLC)
Shaking incubatorThermoFisher Scientific, Waltham, MASHKE4450MaxQ 4450 Benchtop Orbital Shakers
Soil mixSun GroSUN239223328CFLPSun Gro Metro-Mix 360 Grower Mix
SpectinomycinVWR International, Radnor, PAIC15206705
Sterile 50 mL conical tubesUSA Scientific, Ocala, FL1500-181150 mL conical screw cap tubes, copolymer, racks, sterile
SucroseVWR International, Radnor, PA57-50-1Sucrose, ACS
Surfactant solutionLehle seeds, Round Rock, TXVIS-02Silwet L-77
Topoisomerase-based cloning kitLife Technologies, Carlsbad, CAK240020pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
TryptoneVWR International, Radnor, PA90000-282BD Bacto Tryptone, BD Biosciences
Yeast ExtractVWR International, Radnor, PA90000-722 BD Bacto Yeast Extract, BD Biosciences

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43 (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13 (3), 241(2012).
  3. Whited, J. The Next Top Models. Cell. 163 (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. , 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13 (8), 166(2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2 (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164 (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61 (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115 (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163 (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31 (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16 (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61 (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028(2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. , 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347 (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239 (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62 (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. , 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006 (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8 (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135 (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26 (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. , 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2 (1), 127(2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26 (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200 (1), 35-45 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Agrobacterium-mediated TransformationFloral-dip MethodPlant TransformationTransgenic LinesBASTA SelectionAgrobacterium InfiltrationT1 Seed ScreeningGrowth Chamber ConditionsComparative Genomics