A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Summary

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

Abstract

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of γ-³²-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

Introduction

Kinase and pyrophosphokinase (or diphospho-kinase) enzymes transfer phosphates from nucleotide triphosphate (NTP) precursors to substrate molecules. The substrates can include other nucleotides, amino acids or proteins, carbohydrates, and lipids¹. Bioinformatic analyses can sometimes predict an enzyme's cognate substrate or substrates based on the similarity to characterized enzymes, but experimental validation is still necessary. Similarly, the affinity of an enzyme for its substrate(s) and the rate at which it catalyzes the phosphor-transfer reaction, and the effects of co-factors, inhibitors, or other enzyme effectors must be determined ....

Protocol

1. Inducible Overexpression of a Histidine-tagged Protein

1. Amplify rsh from C. difficile R20291 genomic DNA.
   1. Use a high-fidelity polymerase and follow the manufacturer’s instructions.
   2. Amplify C. difficile rsh using primers
      rsh_F(CAGGTACCGGTTATATGCATGATAAAGAATTACAAG) and
      rsh_R(CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), which introduces a C-terminal hexahistidine tag.
      NOTE: The KpnI and PstI cut sites in the primer sequences are bolded.
   3. Digest the pMMBneo vector and the rsh-his6 PCR product with Pstl and KpnI restriction cut sites....

Results

We present a method for the affinity purification of a (p)ppGpp synthetase from Clostridium difficile and the assessment of its enzymatic activity. Figure 1 demonstrates the protein purification achieved by metal affinity chromatography. The second elution (E2) fraction from this purification was dialyzed and used for the enzymatic activity assay. Figure 2 details the necessary steps to prepare for and carry out pyrophos.......

Discussion

Here we report the purification of His-tagged RSH from C. difficile and present a method for activity quantification using radiolabeled thin layer chromatography. This method has previously been used to assess the activity of diguanylate cyclase enzymes from C. difficile, as well as (p)ppGpp synthetase, nucleotide cyclase, kinase and phosphodiesterase enzymes from other organisms^11,12,13,

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Inducible overexpression of a histidine-tagged protein
Phusion polymerase	New England Biolabs (NEB)	M0530L
QIAEX II DNA Gel Extraction Kit	Qiagen	20021
KpnI restriction enzyme	NEB	R0142S
PstI restriction enzyme	NEB	R0140S
T4 DNA ligase	NEB	M0202
NEB® 5-alpha Competent E. coli (High Efficiency)	NEB	C2987I
BL21 (DE3) Competent E. coli	NEB	C2527I
IPTG	Sigma-Aldrich	10724815001
JXN-26 centrifuge with JLA 10.500 rotor	Beckman Coulter Avanti	-
Microcentrifuge with D3024/D3024R rotor	Scilogex	-
MaxQ SHKE6000 Incubator	Thermo Scientific	-
Ultrasonic processor	Sonics	VC-750
Protein purification by nickel affinity chromatography
Ni-NTA resin	G Biosciences	786-940/941
Pierce Disposable Gravity columns, 10 mL	Thermo Scientific	29924
1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)	Spectrum	G235033
Mini-Protean Electrophoresis Cell	BioRad	1658004
Protein activity assay by thin layer chromatography
Thin layer chromatograph (TLC) development tank	General Glass Blowing Company	80-3
Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 μm thickness) with polyester support	Sigma-Aldrich	Z122882-25EA
ATP, [γ-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 μCi	Perkin Elmer	NEG002A
Adenosine 5’-triphosphate (ATP) 100 mM	Bio Basic Canada	AB0311
Guanosine-5’-diphosphate disodium salt (GDP)	Alfa Aesar	AAJ61646MC/E
Storage phosphor screen	GE Healthcare Life Sciences	BAS-IP TR 2040 E Tritium Screen
Storm 860 phosphorimager	GE Healthcare Life Sciences	-