Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Summary

Here, we present a protocol to prepare DNA samples from food and environmental microbiomes for concerted detection and subtyping of Salmonella through quasimetagenomic sequencing. The combined use of culture enrichment, immunomagnetic separation (IMS), and multiple displacement amplification (MDA) allows effective concentration of Salmonella genomic DNA from food and environmental samples. 

Abstract

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, microbiome modification is designed to concentrate genomic DNA of a target foodborne pathogen contaminant to facilitate the detection and subtyping of the pathogen in a single workflow. Here, we explain and demonstrate the sample preparation steps for the quasi-metagenomics analysis of Salmonella enterica from representative food and environmental samples including alfalfa sprouts, ground black pepper, ground beef, chicken breast and environmental swabs. Samples are first subjected to the culture enrichment of Salmonella for a shortened and adjustable duration (4–24 h). Salmonella cells are then selectively captured from the enrichment culture by immunomagnetic separation (IMS). Finally, multiple displacement amplification (MDA) is performed to amplify DNA from IMS-captured cells. The DNA output of this protocol can be sequenced by high throughput sequencing platforms. An optional quantitative PCR analysis can be performed to replace sequencing for Salmonella detection or assess the concentration of Salmonella DNA before sequencing.

Introduction

Metagenomics sequencing theoretically allows concerted detection and subtyping of foodborne pathogens. However, food samples present challenges to the pathogen analysis by direct sequencing of the food microbiome. First, foodborne pathogens are often present at low levels in food samples. Most of the commercially available rapid detection methods still require 8–48 h culturing to enrich pathogen cells to a detectable level¹. Second, many foods contain abundant microflora cells and/or food DNA, making foodborne pathogen DNA a small fraction of food metagenome and an elusive target for detection and subtyping by direct metagenomic sequencing.

Modification of food microbiomes has been reported to allow substantial concentration of foodborne pathogen DNA to facilitate sequencing-based detection of Shiga toxin-producing Escherichia coli^2,3 and Salmonella enterica⁴. Because modified food microbiomes are still mixtures of different microbial species, their sequencing is termed as quasi-metagenomic analysis⁴. Microbiome modification can be performed by culture enrichment alone^2,3 or in combination with immunomagnetic separation (IMS) and multiple displacement amplification (MDA)^4,5. IMS can selectively capture pathogen cells from the enrichment culture via antibody-coated magnetic beads. MDA can generate sufficient amounts of genomic DNA for sequencing through the highly efficient ɸ29 DNA polymerase⁶. IMS-MDA has allowed culture-independent pathogen detection from clinical samples⁷, and shortening of the culture enrichment for quasi-metagenomic detection and subtyping of Salmonella in food samples⁴.

The overall goal of this method is to prepare quasi-metagenomic DNA from food samples to allow targeted concentration of Salmonella genomic DNA and subsequent detection and subtyping of the Salmonella contaminant by sequencing. Compared to standard methods for Salmonella detection^8,9 and subtyping¹⁰, the quasimetagenomic approach can substantially shorten the turnaround time from contaminated food and environmental samples to molecular subtypes of the pathogen by unifying the two typically separated analyses into a single workflow. This method is particularly useful for applications such as foodborne outbreak response and other trace back investigations where robust pathogen subtyping is required in addition to pathogen detection and rapid analytical turnaround is important.

Protocol

1. Sample Preparation

NOTE: Food samples are prepared for pre-enrichment according to Microbiology Laboratory Guidebook (MLG) of U.S. Department of Agriculture Food Safety and Inspection Service (USDA-FSIS)¹¹ and Bacteriological analytical manual (BAM) of U.S. Food and Drug Administration (FDA)¹².

1. Aseptically place a 25 g portion of food sample such as black pepper, chicken breast, ground beef, and alfalfa sprouts or an environmental swab into a sterile laboratory blender bag with a built-in filter. Prepare an environmental swab by aseptically moistening a sponge with enrichment broth (Rappaport-Vassiliadis, RV). Then, drag the swab over entire surface or predetermined area and place it into a laboratory blender bag.

Figure 1: Representative food and environmental samples for quasi-metagenomics detection and subtyping of Salmonella. Samples are placed in sterile filter stomacher bags along with RV broth. Please click here to view a larger version of this figure.

2. Thoroughly mix each 25 g sample with 225 mL of RV enrichment broth using a laboratory blender or hand massage for 30 s.
   NOTE: Variants of RV broth as recommended by MLG and BAM may be used depending on sample types.
3. Incubate sample-enrichment broth mixture in a laboratory incubator at 42 °C for 4–24 h.
4. After incubation, collect a 50 mL subsample of enrichment broth from the filtered side of the bag in a separate 50 mL centrifuge tube.
5. Centrifuge the tube at 100 x g for 10 min to remove solid debris in the homogenate.
6. Recover the supernatant carefully to a new 50 mL centrifuge tube and centrifuge the tubes at 3,000–6,000 x g for 10 min to recover cell pellet.
7. (Optional) Discard the supernatant and wash the pellet by re-suspension in 5 mL of Buffered Peptone Water (BPW) and centrifuge the tubes at 3,000–6,000 × g for 10 min.
   NOTE: BPW can prepared by dissolving 10 g of peptone, 5 g of sodium chloride, 3.5 g of disodium phosphate, and 1.5 g of monopotassium phosphate into 1 L of distilled water. The final pH should be adjusted to 7.2 ± 0.2 at 25 °C. Autoclave at 121 ºC for 15 min. Commercially available BPW can also be used.
8. Discard supernatant and re-suspend the pellet in 5 mL of BPW.

2. Immunomagnetic Separation (IMS) and Multiple Displacement Amplification (MDA)

NOTE: To prevent cross-contamination between samples, work in a biosafety cabinet, change pipette tips for each tube, avoid touching the tube with the pipette, and do not place tubes close together in magnetic stand during the washing step.

1. Thaw the sample buffer and the reaction buffer from the MDA kit on ice or at 4 °C in advance.
2. Mix 1 mL of re-suspended cell pellet in BPW with 20 μL of anti-Salmonella beads in 1.5 mL microcentrifuge tubes and place it on the rotating mixer for 30 min at room temperature.
   NOTE: Competitive flora, fat particulates, and proteins in the resuspended pellet can interfere with IMS. Dilution of re-suspended cell pellet in BPW is helpful to reduce the loss of the bead-Salmonella complexes from the magnetic stand during washing steps.
3. Insert the tubes into the magnetic stand and allow 3 min for the proper recovery of beads by inverting the rack several times to concentrate the beads into a pellet on the side of the tube.
4. Keep the tubes on the magnetic stand. Aspirate and discard the supernatant from each tube, as well as the remaining liquid in each tube’s cap.
   NOTE: Be careful not to disturb the pellet of IMS beads on the side wall of the tube against the magnet.
5. Remove the tube holder from the magnetic stand and add 1 mL of wash buffer (PBS containing 0.05 % (v/v) polysorbate 20) and invert several times to remove non-specifically binding bacteria from the complex.
6. Repeat steps 2.3–2.5 twice.
7. After the 3^rd wash, perform the final magnetic separation of beads by repeating steps 2.3–2.4. Remove tubes from magnetic rack and place them in a microfuge for 1 s to spin down beads. Then, place the tubes in the magnetic rack for 3 min before removing any residual wash buffer.
8. Re-suspend the bead-Salmonella complexes in 9 μL of Sample buffer and incubate at 95 °C for 3 min for denaturation.
9. After cooling to 4 °C on ice, combine with 9 μL of Reaction buffer plus 1 μL of enzyme mix and keep on ice.
10. In a thermal cycler, incubate tubes at 30 °C for 2 h for amplification, followed by heating at 65 °C for 10 min to inactivate the enzyme and cool to 4 °C on ice.
11. Assess the quantity and quality of the MDA products by measuring the DNA concentration and purity (260/280 ratio > 1.8) on a fluorospectrometer instrument.
    NOTE: Because of non-specific binding of IMS beads, genomic DNA from organisms other than Salmonella is likely to be present in the MDA products, but it does not affect downstream analysis.
12. Store the final products (20 μL) at -20 °C until use for real-time PCR and/or library preparation for quasimetagenomics sequencing.

3. Real-Time PCR

NOTE: This step is optional for 1) detecting Salmonella without subtyping, and 2) assessing sample quality prior to quasimetagenomics sequencing.

1. Prepare 18 μL of PCR mixture per sample, containing Universal PCR Master Mix (10 μL), forward primer (2 μL, 900 nM), reverse primer (2 μL, 900 nM), probe (2 μL, 250 nM), and molecular grade water (2 μL).
   Note: Salmonella-specific oligonucleotide primers (forward: CTCACCAGGAGATTACAACATGG, reverse: AGCTCAGACCAAAAGTGACCATC) and probe were designed to amplify a 94-bp sequence within the ttr gene (GenBank accession no. AF 282268)¹³.
2. Mix the MDA product from step 2.12 by gently pipetting up and down bead-Salmonella complexes along with liquid to create a suspension. Add 2 μL of the suspension into 18 μL of PCR mixture.
3. Run real-time PCR using an optimized real-time PCR protocol, specifying two holding periods, one at 50 °C for 2 min and another at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s.
4. Calculate the threshold cycle (Ct), which is the number of cycles required for the fluorescence from the amplified DNA to cross the threshold line.
   NOTE: The threshold line is set in the linear phase between base line and plateau of the amplification plots of samples. Negative results correspond to Ct values over 40 or samples with Ct values higher than that of negative control.

4. Library Preparation for Quasimetagenomic Sequencing

NOTE: The MDA products can be sequenced by both short read and long read (nanopore) sequencing platforms. Use the latest version of DNA library prep kits provided by the manufacturers of the sequencing platforms. Perform DNA library preparation according to manufacturers’ instruction. Use the 2D low-input genomic DNA protocol for library preparation for the long-read sequencing platform⁵. For library preparation for the short-read sequencing platform, minor modifications to the manufacturer’s protocol are provided below.

1. Follow standard library preparation methods by adding buffer solutions and reagents to MDA products. Transfer 40 μL of the sequencing prepped MDA  products to a new plate and add 20 μL of PCR purification beads to each well.
2. Incubate the plate at room temperature for 10 min without shaking.
3. Wash the beads with 80% ethanol and dry the beads for 12 min.
4. Re-suspend dried beads in 53 μL of resuspension buffer and incubate for 2 min without shaking.
5. Dilute and pool libraries following manufacturer’s instruction.
   NOTE: A 10 pM pooled and denatured library is now ready to be sequenced.

Results

Prior to quasimetagenomic sequencing, the overall quantity and purity of IMS-MDA products can be evaluated by fluorospectrometer (Table 1).

	Enrichment time (h)	Ct value	Concentration (ng/ul)	Purity (260/280)

Discussion

Because of the often-low abundance and in-homogenous presence of Salmonella in food and environmental samples, culture enrichment before IMS-MDA is still necessary for Salmonella detection and subtyping; it is therefore a critical step of the protocol. To identify optimal conditions to increase the abundance of Salmonella relative to sample background flora, different enrichment media may be evaluated for specific samples. According to MLG and BAM, both selective medium such as RV broth and non...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Laboratory blender bag w/filter	VWR	10048-886
Buffered peptone water	Oxoid Micorbiology Products	CM0509
Rappaport Vassiliadis broth	Neogen Acumedia	7730A
Polysorbate 20	Millipore Sigma	P9416	Tween 20
Stomacher blender	Seward	30010108
Centrifuge	Fisher Scientific	75005194
50 mL Centrifuge tubes	Fisher Scientific	05-539-6
Thermal Cycler	Techne Prime	EW-93945-13
StepOne Real-Time Thermal cycler	Applied Biosystems	4.76357
AMPure XP beads	Beckman Coulter	A63881	PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit	Illumina	FC-131-1024	Store at -80 °C
MinIon library prep kit	Oxford Nanopore	SQK-LSK108	Store at -80 °C
NanoDrop	Thermo Scientific	ND-2000
Dynabead Anti-Salmonella beads	Applied Biosystems	71002	Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit) -Sample buffer -Reaction buffer -Enzyme mix	GE Healthcare	25-6600-30	Store at -80 °C
HulaMixer	Invitrogen	15920D
DynaMag magnetic rack	Invitrogen	12321D
TaqMan Universal PCR mastermix	Applied Biosystems	4304437	Mix well before use; store at 4 °C
Microfuge	Fisher Scientific	05-090-100