A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

10.1K views

DOI:

10.3791/58845

March 14th, 2019

* These authors contributed equally

In This Article

Summary

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Abstract

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Introduction

Emerging viral infections, especially by arboviruses, such as the Chikungunya virus1, the Dengue virus, the Yellow fever virus2 and the Zikavirus3, have been a huge threat to public health by causing pandemics4. Thus, a better understanding of virus-host interaction has become increasingly important for epidemic control and treatment of viral diseases in humans. For this goal, more appropriate and efficient models must be established to investigate the mechanisms underlying virus infection.

The fruit fly, Drosophilamelanogaster (D. melanogaster), provides a powerful system to investigate virus-host interaction5,6 and has proven to be one of the most efficient models to study human viral diseases7,8,9. Highly conserved antiviral signaling pathways and incomparable genetic tools make flies a great model to produce significant results with real implications for human antiviral studies. In addition, flies are easy and inexpensive to maintain in the laboratory and are convenient for large-scale screening of novel regulatory factors6,10 in the virus and the host during infection.

Four major highly conserved antiviral pathways (e.g., the RNA interference (RNAi) pathway11, the JAK-STAT pathway12, the NF-κB pathway, and the autophagy pathway13) are well studied in Drosophila in recent years6. The RNAi pathway is a broad antiviral mechanism that can suppress most kinds of virus infection6,14. Disruption of this pathway by mutation in genes like Dicer-2 (Dcr-2) or Argonaute 2 (AGO2) can lead to increased virus titer and host mortality15,16,17. The JAK-STAT pathway has been implicated in control of infection by a virus from the Dicistroviridae family and the Flaviviridae family in insects, e.g., Drosophila C virus (DCV) in flies16 and West Nile virus (WNV) and Dengue Virus in mosquito18,19. The Drosophila Toll (homologous to the human NF-κB pathway) and Immune deficiency (IMD) pathways (similar to the human NF-κB and TNF pathway) are both involved in defending virus invasion20,21,22. Autophagy is another conserved mechanism involved in the regulation of viral infection, which is well characterized in Drosophila23,24. Thus, identification of novel regulatory factors of these pathways and dissecting crosstalk between these antiviral signaling and other biological pathways, such as metabolism, aging, neural reaction and so on, can be easily set up in the Drosophila system.

Although most well-established viral infectious models in Drosophila are induced by RNA viruses, infection by the Invertebrate iridescent Virus 6I (IV-6) and Kallithea viruses have shown the potential for study of DNA viruses in flies25,26. Moreover, the virus can also be modified to allow infection of Drosophila, such as the influenza virus9. This has greatly expanded the application of the Drosophila screening platform. In this procedure, we use DCV as an example to describe how to develop a viral infectious system in Drosophila. DCV is a positive-sense single stranded RNA virus of approximately 9300 nucleotides, encoding 9 proteins27. As a natural pathogen of D. melanogaster, DCV is considered as a suitable virus to study host physiological, behavioral and basal immune response during host-virus interaction and co-evolution28. Additionally, its rapid mortality rate following infection in wild type flies makes DCV useful to screen for resistant or susceptible genes in the host29.

However, there are several aspects of concern when studying viral infections in Drosophila. For example, symbiotic bacteria Wolbachia have an ability to inhibit a wide spectra of RNA virus proliferation in Drosophila and mosquito30,31,32. Recent evidence shows a possible mechanism in which Wolbachia blocks Sindbis virus (SINV) infection through the upregulation of methyltransferase Mt2 expression in the host33. Additionally, the genetic background of insects is also critical for viral infection. For instance, the natural polymorphism in the gene, pastrel (pst), determines the susceptibility to DCV infection in Drosophila34,35, whilst the loci of Ubc-E2H and CG8492 are involved in Cricket paralysis virus (CrPV) and Flock house virus (FHV) infection, respectively36.

The particular ways to establish the virus-host interaction in flies, must be chosen according to research purposes such as a high-throughput screen for host cellular components in Drosophila cell lines37,38, oral infection to study gut-specific antiviral response22,39,40, needle pricking41,42 or nano-injection by passing epithelial barriers to stimulate systemic immune responses. Nano-injection can precisely control the viral dose to induce a controlled antiviral reaction and a physiological lesion43, thus guaranteeing high experimental reproducibility44. In this study, we describe a nano-injection method to study virus-host interactions in Drosophila, highlighting the importance of the flies' background effects.

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: Before starting experiment, the cell lines and fly stocks used must not be contaminated by other pathogens, especially for viruses such as DCV, FHV, Drosophila X virus (DXV), and Avian nephritis virus (ANV). Ideally, RNA sequencing or a simpler PCR-based identification are used to detect the contamination10,45. If contamination occurred, the cell lines and fly stocks should not be used any more until they are decontaminated completely46.

1. Virus and Fly Preparation

  1. Virus propagation and collection
    NOTE: Drosophila S2* cells are used for DCV propagation and titration. The S2* cell line is derived from a primary culture of late stage D. melanogaster embryos. This cell line has been well described previously47.
    1. Grow S2* cells in Schneider’s Drosophila Medium at 25 °C without additional CO2, as a loose, semi-adherent monolayer in a 10 cm cell culture dish, at a density of 1 x 107 viable cells/mL. Use complete medium for S2* cells: Schneider’s Drosophila Medium containing 10% heat inactivated FBS, 100 units/mL Penicillin and 100 μg/mL Streptomycin.
      NOTE: Healthy cells should show a round shape and exhibit homogenous size.
    2. Quickly thaw the DCV stock from -80 °C in a 25 °C water bath. Infect S2* cells with DCV at MOI = 0.01 immediately by directly adding 1 mL of virus solution to the cell culture dishes (growth area: 55 cm2) with 10 mL of complete medium for S2* cells.
    3. Incubate cells at 25 °C for 3 to 5 days. When the virus is ready for collection, the cell morphology is abnormal (cell shape looks blur) and the culture medium is full of black particles indicative of cell debris.
    4. Collect the whole cell culture in a 15 mL tube by pipetting up and down and freeze at -80 °C (for up to a year).
      NOTE: DCV can be stored for prolonged periods of time at -80 °C with minimal loss of infectivity, for up to one year.
    5. Thaw the cell culture in a 25 °C water bath with constant shaking and then centrifuge at 6,000 x g, for 15 min at 4 °C. Collect the supernatant in a sterile 15 mL tube and vortex. Aliquot up to 200 μL of virus solution per tube.
      NOTE: Virus aliquots can be stored for short periods of up to 3 days at 4 °C and for up to 1 year at -80 °C. Repeated freeze-thaw cycles should be avoided. It is always better to use all the aliquot at once.
    6. Pick 5 random virus-containing tubes to determine the average virus tissue culture infective dose (TCID50) by a cytopathic effect (CPE) assay (1 unit of TCID50= 0.7 plaque forming unit [PFU]).
      NOTE: CPE refers to structural changes in host cells caused by viral invasion. The infecting virus causes lysis of the host cell or when the cell dies without lysis due to an inability to reproduce48.
      1. On day 1, collect prepared S2* cells by pipetting. Count the cell number. Centrifuge cells for 300 x g for 4 min and discard the supernatant. Dilute the cells to the density of 1 x 106 cells/mL with complete medium for S2* cells as described in step 1.1.1.
      2. Seed 1 x 105 S2*cells (100 μL) per well to the flat-bottom 96-well-plate (~30% confluency).
      3. Perform serial 10-fold dilutions of the DCV stock with complete medium for S2* cells. Add 50 µL dilutions into the well. Add 50 µL of culture medium without virus to the well classified as the negative control well.
        NOTE: For each dilution rate, 8 wells were used. As the typical DCV yield is around 108-109 PFU/mL, the dilution should at least cover ~10-5-10-10.
      4. On day 4, observe CPE with a bright-field microscope with a 20X or 40X objective. Classify a well in which the cells look blurry and the medium is full of fragments as a "positive well", and a well in which the cell morphology is normal as “negative well”.
      5. Mark CPE positive or negative wells with + or –, respectively. Calculate the virus TCID50 by the Reed and Muench method49.
    7. Dispose of all contaminated materials and gloves in the decontamination pan. If the virus cannot reach the desired TCID50, concentrate 100 mL of virus solution by centrifuging at 68,000 x g for 1 h at 4 °C.
      NOTE: Depending on the aim of the experiment, a range of doses from 102 to 106 TCID50 units can be used for virus infection. Typically, we use 3 x 106 TCID50 units.
    8. Discard the supernatant and re-suspend in 1 mL of Tris-HCl buffer (10 mM, pH 7.2). Aliquot 20 μL of virus solution per tube and store at -80 °C. Pick 5 random tubes to determine the average virus TCID50 again.
  2. Fly preparation for infection
    NOTE: Symbiotic bacteria Wolbachia can suppress many kinds of RNA virus infection in insects30,31,32,33,41. Thus, it is essential to purge Wolbachia from flies before studying host-virus infection in vivo33.
    1. Prepare fly food containing tetracycline by adding 400 μL of 50 µg/mL tetracycline (in 70% ethanol) to 4 g of fresh standard cornmeal fly food (1 L of food contains 77.7 g of cornmeal, 32.19 g of yeast, 10.6 g of agar, 0.726 g of CaCl2, 31.62 g of sucrose, 63.3 g of glucose, 2 g of potassium sorbate and 15 mL of 5% C8H8O3). Mix thoroughly and place the food at 4 °C overnight to evaporate ethanol.
      NOTE: A high dose of ethanol may affect fly fertility, so do NOT omit this step.
    2. Warm the food to room temperature and put newly eclosed adult flies (20 females and 10 males) in the vial. Breed the flies at 25 °C, 60% humidity under a normal light/dark cycle.
      NOTE: Typically, it takes 3-4 days for the flies to lay enough eggs. Too many eggs inhibit larvae development and decrease tetracycline efficiency.
    3. Collect newly eclosed adult flies (within 3~5 days) under a light flow of CO2, and repeat step ~1.2.1-1.2.2. Typically, at least 3 generations are required for the completely elimination of Wolbachia.
    4. After 3 generations with tetracycline treatment, collect 5 flies under a light flow of CO2 for the Wolbachia infection test. Grind flies for 1 min with 250 μL of double-distilled water (ddH2O) and a few 0.5 mm sterile ceramic beads in a 1.5 mL tube using a homogenizer. Add another 250 μL of 2x buffer A (0.2 M Tris-HCl, pH 9.0; 0.2 M EDTA; 2% SDS) to the sample and vortex.
      NOTE: Since SDS will impede the bead movement, 1x buffer A cannot be directly used to grind flies. If the flies have red eyes, remove heads before grinding, as this may influence the color of DNA product.
    5. Freeze the samples at -80 °C (keep for up to one year). Quickly thaw the the sample from -80 °C in a 25 °C water bath until dissolved. Incubate the samples at 70 °C for 30 min.
    6. Add 190 μL of 5 M KOAc, vortex and incubate on ice for 15 min or longer.
    7. Centrifuge samples at 13,000 x g for 5 min at room temperature, collect the supernatant and transfer them to new tubes.
    8. Repeat step 1.2.7 to obtain DNA with better quality.
    9. Add 750 μL of isopropanol to each sample and gently invert a few times by hand. Incubate at room temperature for 5 min.
    10. Centrifuge samples at 13,000 x g for 5 min at room temperature and discard the supernatant. The white genomic DNA pellet will stay at the bottom of the tube.
    11. Add 1 mL of 70% ethanol to the pellets, centrifuge at 13,000 x g for 5 min, and discard the supernatant. Air-dry the DNA until it becomes transparent.
    12. Dissolve DNA in 100 μL of ddH2O, titrate DNA concentration by UV-Vis absorption spectrophotometry and dilute the DNA to 100 ng/μL.
    13. Use 200 ng of DNA for the PCR reaction (in a 20 μL system, see the Table of Materials). Perform PCR by the following program: 95 °C for 15 min; 36 cycle of 95 °C for 45 s, 50 °C for 45 s, and 72 °C for 1 min; and a final extension step (72 °C for 1 min) in a thermal cycler.
      NOTE: Based on the Wolbachia 16S rRNA, use the following primers: 5’ TGAGGAAGATAATGACGG 3’ (forward) and 5’ CCTCTATCCTCTTTCAACC 3’ (reverse). For wsp, the primers were 5’ CATTGGTGTTGGTGTTGGTG 3’ (forward) and 5’ ACCGAAATAACGAGCTCCAG 3’ (reverse).
    14. Analyze PCR products with 1% agarose gel electrophoresis. The PCR product size of Wolbachia 16S rRNA and wsp is around 200 bp and 600 bp, respectively.
    15. Rear Wolbachia free fly stock on standard cornmeal fly food. Collect 3-5 day newly eclosed male flies for infection.
      NOTE: Tetracycline treatment can also affect intestinal microbiota composition, which subsequently influences antiviral responses in the host. We recommend that all flies should receive the same tetracycline treatments. Keep Wolbachia-free flies growing under standard conditions for at least 3 generations to restore gut microbiota.
  3. Pastrel genotyping
    NOTE: The presence of the S or R allele of the pst gene in the genetic background has been reported to affect DCV infection in Drosophila34,35. It is necessary to check the pst genotype, especially for DCV infection. There are a few SNPs in pst that can affect virus infection, the major SNP is 512C/T. The temperature gradient PCR is a quick method to identify pst genotype.
    1. Extract fly genomic DNA as described above (step 1.2.4 - 1.2.15).
    2. Use 100 ng of DNA as the template, the 512C primer, 5’ CAGCATGGTGTCCATGAAGTC 3’ (forward) and 5’ ACGTGATCAATGCTGAAAGT 3’ (reverse) to detect the R allele, the 512T primer, 5’ CAGCATGGTGTCCATGAAGTT 3’ (forward) and 5’ ACGTGATCAATGCTGAAAGT 3’ (reverse) to detect the S allele.
    3. Set the Tm (melting temperature) gradients as follows: 54 °C, 54.7 °C, 55.5 °C, 58 °C, 59.7 °C, 62.2 °C, 63.7 °C, and 64 °C (45 s at each temperature).
      NOTE: 30 cycles of PCR chain reaction are recommended (20 μL system).
    4. Visualize the 100-bp PCR product by 2% agarose gel electrophoresis.

2. Viral Infection in Drosophila

  1. Infect flies by nano-injection and perform survival assays.
    1. Pull the capillaries to prepare injection needles, back-fill the injection needle with oil and assemble the injector as previously described50.
    2. Anaesthetize flies on the pad under a light flow of CO2. Inoculate flies by intra-thoracic injection44 of 50.6 nL of virus solution (100 PFU, diluted with Tris-HCl buffer, pH 7.2). Inject at least 3 vials of flies (20 flies per vial).
      NOTE: The injection is time-consuming (generally 100 flies per hour) and DCV replication is very rapid, so it is very important to write down the exact time on the tube once finishing each vial (20 flies). Buffer only injection is set as a mock control. Usually, male adult flies are preferred, as results are more stable and reproducible than when using females since hormonal variations during mating and reproduction may influence the readout of females51.
    3. Grow the injected flies at 25 °C, 60% humidity under a normal light/dark cycle. Supply flies with fresh food daily and record the number of dead flies.
    4. Perform at least 3 biological replicates and plot the survival curve.
    5. For the statistical analysis of survival data, generate Kaplan-Meier survival curves by statistical software. Perform log-rank test to calculate the P values. On the survival table, enter information for each subject. The software then computes percent survival at each time, and plots a Kaplan-Meier survival plot.
      NOTE: Do NOT add additional yeast into the vial. Compared with mock controls, DCV-infected flies occasionally have ascites and are clumsy, which make them vulnerable to the sticky yeast. It is better to record more time points in the preliminary experiment to find out a time frame at which the massive death will happen for infected flies. Generally, the infected flies rarely die within the first two days, even for the Dcr-2 mutant lines. For the Wolbachia free w1118 (Bloomington 5905) fly infected with 100 PFU of DCV, this time window is around 3-5 days post infection. Fruit flies that die within 0.5 h post injection hours should not be counted as a fatality because they may be killed by needle injury not by viral infection.
  2. DCV load measure by CPE assay
    NOTE: Viral load is measured similarly to the titration of the virus stock (Step 1.1.6) but requires additional sample preparation (step 2.2.1-2.2.4).
    1. On day 1, infect male flies as described in step 2.1.1-2.1.2. Group injected flies in groups of 20 and keep them growing on fresh fly food for the desired time (typically for 24 h or 3 days). Provide flies with fresh food daily.
    2. On day 2, seed Drosophila S2* cells in a 10 cm cell culture dish to the density of approximately 5 x106 to 1x107 cells/mL as described in step 1.1.1.
    3. On day 3, collect 5 flies (under a light flow of CO2) and grind them in a 1.5 mL centrifuge tube for 30 s with 200 μL of Tris buffer and ceramic beads using homogenizer. Store the samples at -80 °C or immediately proceed to the next step.
    4. Thoroughly vortex the sample. Use a 1 mL syringe and 0.22 μm filter to filter the supernatant to a new 1.5 mL tube. Proceed with the titration, as described in steps 1.1.6.1-1.1.6.5.
  3. DCV load measured by qRT-PCR
    1. On day 1, infect flies as described above. Group injected male flies (20 flies/group) and grow on fresh fly food for desired time, typically for 24 h or 3 days. Provide flies with fresh food daily.
    2. On day 3, collect 5 flies under a light flow of CO2 in a 1.5 mL tube with 200 μL of lysis buffer and 20 ceramic beads (diameter = 0.5 mm), grind the samples by homogenizer with high speed for 30 s. Add 800 μL of additional lysis buffer to each tube and store the samples at -80 °C or immediately conduct RNA extraction and qRT-PCR.
    3. Prepare RNase free tips, tubes and deionized, diethylpyrocarbonate (DEPC) treated and 0.22 µm membrane-filtered water. Add 200 μL of chloroform (≥99.5%) into the sample and vigorously shake for 15 s by hand. Incubate for 5 min or longer at room temperature until the water phase and the organic phase are clearly separated.
      NOTE: Chloroform is extremely hazardous and must be handled with care. Do NOT vortex the sample, which will increase the risk of DNA contamination.
    4. Centrifuge samples at 13,000 x g for 15 min at 4 °C.
    5. Collect 400 μL of supernatant and transfer the supernatant to new tubes. Mix with the same volume isopropanol (≥ 99.5%), gently invert the samples for 20 times by hand, and then precipitate for 10 min or longer at room temperature.
      NOTE: Precipitation at -20 °C will increase RNA yield.
    6. Centrifuge samples at 13,000 x g for 10 min at 4 °C. White RNA pellets are visible at the bottom of the tube.
    7. Discard the supernatant and add 1 mL of 70% ethanol (ethanol in DEPC water) and invert few times to wash the RNA.
    8. Centrifuge samples at 13,000 x g for 5 min at 4 °C. Discard the supernatant and dry RNA for 5-10 min; RNA should become transparent.
    9. Add 50 μL of DEPC water to the sample, pipette for few times and vortex.
    10. Take 3 μL of RNA for titrating the RNA concentration. Quantify the RNA at 260 nm. Normally, the RNA concentration extracted by this protocol is approximately 100-500 μg/μL, which is suitable for cDNA synthesis.
    11. Use 2 μg of RNA for cDNA synthesis. Dilute the sample to 100 μL with ddH2O and store at -20 °C.
    12. Perform qRT-PCR according to the manufacturer's instructions and run qRT-PCR.
      NOTE: For cDNA synthesis of DCV, random primers worked much better than Poly A primer in our hands. DCV mRNA expression is normalized to endogenous ribosomal protein 49 (rp49) mRNA. Oligonucleotide primers used in this part: rp49 5’ AGATCGTGAAGAAGCGCACCAAG 3’ (forward) and 5’ CACCAGGAACTTCTTGAATCCGG 3’ (reverse); DCV, 5’ TCATCGGTATGCACATTGCT 3’ (forward) and 5’ CGCATAACCATGCTCTTCTG 3’ (reverse); vago, 5’ TGCAACTCTGGGAGGATAGC 3’ (forward) and 5’ AATTGCCCTGCGTCAGTTT 3’ (reverse); virus-induced RNA 1 (vir-1) 5’ GATCCCAATTTTCCCATCAA 3’ (forward) and 5’ GATTACAGCTGGGTGCACAA 3’ (reverse).

Access restricted. Please log in or start a trial to view this content.

Results

Results of this section are obtained after DCV infection of D. melanogaster. Figure 1 shows the flow chart of viral infection in Drosophila. Flies are injected intra-thoracically, and then the samples are collected for the measurement of the viral TCID50 and the genome RNA level (Figure 1). Virus infection can induce cell lysis and CPE is observed at 3 days post infection (Figure 2A). The virus load measured by the CPE assay is in line with t...

Access restricted. Please log in or start a trial to view this content.

Discussion

In this article, we present a detailed procedure on how to establish a viral infectious system in adult Drosophila melanogaster using nano-injection. The protocols include the preparation of appropriate fly lines and virus stock, infection techniques, the evaluation of infectious indicators and the measurement of the antiviral response. Although DCV is used as an example of a viral pathogen, tens of different kinds of virus have been successfully applied for study in the Drosophila system. In addition, hundreds ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We would like to thank the entire Pan lab in IPS. CAS. We thank Dr. Lanfeng Wang (IPS, CAS) for experimental assistance and Dr. Gonalo Cordova Steger (Springer nature), Dr. Jessica VARGAS (IPS, Paris) and Dr. Seng Zhu (IPS, Paris) for comments. This work was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences to L.P (XDA13010500) and H.T (XDB29030300), the National Natural Science Foundation of China to L.P (31870887 and 31570897) and J.Y (31670909). L.P is a fellow of CAS Youth Innovation Promotion Association (2012083).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.22um filterMilliporeSLGP033RS
1.5 ml Microcentrifuge tubesBrand352070
1.5 ml RNase free Microcentrifuge tubesAxygenMCT-150-C
10 cm cell culture dishSigmaCLS430167Cell culture
100 Replacement tubesDrummond Scientific3-000-203-G/X
15 ml tubeCorning352096
ABI 7500 qPCR systemABI7500qPCR
Cell IncubatorSanyoMIR-553
CentrigugeEppendof5810R
CentrigugeEppendof5424R
ChloroformSigma151858RNA extraction
DEPC waterSigma95284-100MLRNA extraction
Drosophila IncubatorPercivalI-41NLRearing Drosophila
FBSInvitrogen12657-029Cell culture
flat bottom 96-well-plateSigmaCLS3922Cell culture
Fluorescence microscopeOlympusDP73
Isopropyl alcoholSigmaI9516RNA extraction
Lysis buffer (RNA extraction)Thermo Fisher15596026TRIzol Reagent
Lysis buffer (liquid sample RNA extraction)Thermo Fisher10296028TRIzol LS Reagent
MicroscopeOlympusCKX41
Nanoject II Auto-Nanoliter InjectorDrummond Scientific3-000-204Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive FilmABI4360954qPCR
Penicillin-Streptomycin, LiquidInvitrogen15140-122Cell culture
qPCR plateABIA32811qPCR
Schneider’s Insect MediumSigmaS9895Cell culture
statistical softwareGraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMixTransScriptAT301RNA extraction
VortexIKAVORTEX 3RNA extraction

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410(2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. , (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391(2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210(2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020(2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436(2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507(2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050(2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. , (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2(2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237(2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702(2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427(2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057(2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. , 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. , (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210(2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250(2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896(2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342(2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. , Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. , 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. , e52613(2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Nanoinjection MethodVirus Load MeasurementAntiviral Pathway AssessmentWolbachia-Free FliesCytopathic Effect AssayQuantitative RT PCRGenetic ScreenInnate Immunity