Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Summary

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique.  

Abstract

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Introduction

Biological activities are ultimately carried out by proteins, most of which interact with others for proper biological functions. Using a computational approach, the total amount of protein-protein interactions in human is estimated to be ~650,000¹, and disruption of these interactions often leads to diseases². Due to their essential roles in controlling cellular and organismal processes, numerous methods have been developed to study protein-protein interactions, such as yeast-two-hybrid, bimolecular fluorescence complementation, split-luciferase complementation, and co-immunoprecipitation assay³. While these methods are good at discovering and confirming protein-protein interactions, they are usually non-quantitative and thus provide limited information about the affinity between the interacting protein partners. Quantitative pull-downs can be used to measure the binding affinity (e.g., the dissociation constant K_d), but it does not measure the kinetics of the binding, nor can it be applied when the K_d is very low due to an inadequate signal-to-noise ratio⁴. Surface plasmon resonance (SPR) spectroscopy quantifies the binding kinetics, but it requires a specific surface and immobilization of one reactant on the surface, which can potentially change the binding property of the reactant⁵. Moreover, it is difficult for SPR to measure fast association and dissociation rates⁵, and it is not appropriate to use SPR to characterize the event of exchanging protein subunits in a protein complex. Here, we describe a method that allows measuring rates of protein complex assembly and disassembly at a millisecond time scale. This method was essential for determining the role of Cullin-associated-Nedd8-dissociated protein 1 (Cand1) as the F-box protein exchange factor^6,7.

Cand1 regulates the dynamics of Skp1•Cul1•F-box protein (SCF) E3 ligases, which belong to the large family of Cullin-RING ubiquitin ligases. SCFs consist of the cullin Cul1, which binds the RING domain protein Rbx1, and an interchangeable F-box protein, which recruits substrates and binds Cul1 through the adaptor protein Skp1⁸. As an E3 ligase, SCF catalyzes the conjugation of ubiquitin to its substrate, and it is activated when the substrate is recruited by the F-box protein, and when Cul1 is modified by the ubiquitin-like protein Nedd8⁹. Cand1 binds unmodified Cul1, and upon binding, it disrupts both the association of Skp1•F-box protein with Cul1 and the conjugation of Nedd8 to Cul1^10,11,12,13. As a result, Cand1 appeared to be an inhibitor of SCF activity in vitro, but Cand1 deficiency in organisms caused defects that suggests a positive role of Cand1 in regulating SCF activities in vivo^14,15,16,17. This paradox was finally explained by a quantitative study that revealed the dynamic interactions among Cul1, Cand1, and Skp1•F-box protein. Using fluorescence resonance energy transfer (FRET) assays that detect the formation of the SCF and Cul1•Cand1 complexes, the association and dissociation rate constants (k_on and k_off, respectively) were measured individually. The measurements revealed that both Cand1 and Skp1•F-box protein form extremely tight complex with Cul1, but the k_off of SCF is dramatically increased by Cand1 and the k_off of Cul1•Cand1 is dramatically increased by Skp1•F-box protein^6,7. These results provide the initial and critical support for defining the role of Cand1 as a protein exchange factor, which catalyzes the formation of new SCF complexes through recycling Cul1 from the old SCF complexes.

Here, we present the procedure of developing and using the FRET assay to study the dynamics of the Cul1•Cand1 complex⁷, and the same principle can be applied to study the dynamics of various biomolecules. FRET occurs when a donor is excited with the appropriate wavelength, and an acceptor with excitation spectrum overlapping the donor emission spectrum is present within a distance of 10-100 Å. The excited state is transferred to the acceptor, thereby decreasing the donor intensity and increasing the acceptor intensity¹⁸. The efficiency of FRET (E) depends on both the Förster radius (R₀) and the distance between the donor and acceptor fluorophores (r), and is defined by: E = R₀⁶/(R₀⁶ + r⁶). The Förster radius (R₀) depends on a few factors, including the dipole angular orientation, the spectral overlap of the donor-acceptor pair, and the solution used¹⁹. To apply the FRET assay on a stopped-flow fluorimeter, which monitors the change of the donor emission in real-time and enables measurements of fast k_on and k_off, it is necessary to establish efficient FRET that results in a significant reduction of donor emission. Therefore, designing efficient FRET by choosing the appropriate pair of fluorescent dyes and sites on the target proteins to attach the dyes is important and will be discussed in this protocol.

Protocol

1. Design the FRET assay.

1. Download the structure file of the Cul1•Cand1 complex from the Protein Data Bank (file 1U6G).
2. View the structure of the Cul1•Cand1 complex in PyMOL.
3. Use the Measurement function under the Wizard menu of PyMOL to estimate the distance between the first amino acid of Cand1 and the last amino acid of Cul1 (Figure 1).
4. Load the online spectra viewer (see Table of Materials) and view the excitation and emission spectra of 7-amino-4-methylcoumarin (AMC) and FlAsH simultaneously (Figure 2). Note that AMC is the FRET donor and FlAsH is the FRET acceptor.

Figure 1: The crystal structure of Cul1•Cand1 and measurement of the distance between potential labeling sites. The crystal structure file was downloaded from Protein Data Bank (File 1U6G), and viewed in PyMOL. Measurements between selected atoms were done by PyMOL. Please click here to view a larger version of this figure.

Figure 2: The excitation and emission spectra of the fluorescent dyes for FRET. Spectra of AMC (7-amino-4-methylcoumarin) and FlAsH are shown. Dashed lines indicate excitation spectra, and solid lines indicate emission spectra. The image was originally generated by the Fluorescence SpectraViewer and was modified for better clarity. Please click here to view a larger version of this figure.

2. Preparation of Cul1^AMC•Rbx1, the FRET donor protein

1. Construct plasmids for expressing human Cul1^sortase•Rbx1 in E. coli cells. Note that the two plasmids co-expressing human Cul1•Rbx1 in E. coli cells are described in detail in a previous report²⁰.
   1. Add a DNA sequence coding “LPETGGHHHHHH” (sortase-His₆ tag) to the 3’ end of Cul1 coding sequence through standard PCR and cloning methods^21,22.
   2. Sequence the new plasmid to confirm the gene insert is accurate.
2. Co-express Cul1^sortase•Rbx1 in E. coli cells. The method is derived from a previous report²⁰.
   1. Mix 100 ng each of the two plasmids with BL21 (DE3) chemically competent cells for co-transformation using the heat shock method²³. Grow cells on LB agar plate containing 100 µg/mL ampicillin and 34 µg/mL chloramphenicol at 37 °C overnight.
   2. Inoculate 50 mL of LB culture with freshly transformed colonies and grow overnight at 37 °C with 250 rpm shaking. This gives a starter culture.
   3. Inoculate 6 flasks, each with 1 L of LB medium, with 5 mL starter culture each and grow at 37 °C with 250 rpm shaking until the OD₆₀₀ is ~1.0. Cool the culture to 16 °C and add isopropyl-β-D-thiogalactoside (IPTG) to 0.4 mM. Keep the culture at 16 °C overnight with 250 rpm shaking.
   4. Harvest the E. coli cells through centrifugation at 5,000 x g for 15 min and collect cell pellets in 50 mL conical tubes.
      NOTE: The cell pellets can be processed for protein purification or be frozen at -80 °C before proceeding to the protein purification steps.
3. Purification of the Cul1^sortase•Rbx1 complex. This method is derived from a previous report²⁰.
   1. Add 50 mL of lysis buffer (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glycerol, 1 tablet of protease inhibitor cocktail, pH 7.6) to the pellet of E. coli cells expressing Cul1^sortase•Rbx1.
   2. Lyse the cells on ice with sonication at 50% amplitude. Alternate between 1-second ON and 1-second OFF and run for 3 min.
   3. Repeat step 2.3.2 2-3x.
   4. Transfer the cell lysate into a 50-mL centrifugation tube and remove the cell debris by centrifugation at 25,000 x g for 45 min.
   5. Incubate the clear cell lysate with 5 mL of glutathione beads at 4 °C for 2 h.
   6. Centrifuge the beads-lysate mixture at 1,500 x g for 2 min at 4 °C. Remove the supernatant.
   7. Wash the beads with 5 mL of lysis buffer (with no protease inhibitors) and remove the supernatant after centrifugation at 1,500 x g for 2 min at 4 °C.
   8. Repeat step 2.3.7 2x.
   9. Add 3 mL of lysis buffer to the washed beads and transfer the bead slurry into an empty column.
   10. Add 5 mL of elution buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM reduced glutathione, pH 8.0) into the column. Incubate for 10 min and collect the eluate.
   11. Repeat step 2.3.10 3-4x.
   12. Add 200 µL of 5 mg/mL thrombin (see Table of Materials) to the eluate from the glutathione beads and incubate overnight at 4 °C.
       NOTE: The protocol can be paused here.
   13. Dilute the protein sample with Buffer A (25 mM HEPES, 1 mM DTT, 5% glycerol, pH 6.5) threefold.
   14. Equilibrate a cation exchange chromatography column (see Table of Materials) on an FPLC system with Buffer A.
   15. Load the protein sample to the equilibrated cation exchange chromatography column at a 0.5 mL/min flow rate.
   16. Elute the protein with a gradient of NaCl in 40 mL by mixing Buffer A and 0 to 50% Buffer B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 6.5) at a 1 mL/min flow rate.
   17. Check the eluted protein in different fractions using SDS-PAGE²⁴.
       NOTE: The protocol can be paused here.
   18. Pool the eluate fractions containing Cul1^sortase•Rbx1.
   19. Concentrate the pooled Cul1^sortase•Rbx1 sample to 2.5 mL by passing the buffer through an ultrafiltration membrane (30 kDa cutoff).
4. Add AMC to the C-terminus of Cul1 through sortase-mediated transpeptidation^21,22.
   1. Change the buffer in the Cul1^sortase•Rbx1 sample to the sortase buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl₂, pH 7.5) using a desalting column (see Table of Materials).
      1. Equilibrate a desalting column with 25 mL of sortase buffer.
      2. Load 2.5 mL of Cul1^sortase•Rbx1 sample into the column. Discard the flow-through.
      3. Elute the sample with 3.5 mL of sortase buffer. Collect the flow-through.
   2. In 900 µL of the Cul1^sortase•Rbx1 solution in the sortase buffer, add 100 µL of 600 µM purified sortase A solution and 10 µL of 25 mM GGGG^AMC peptide. Incubate the reaction mixture at 30 °C in the dark overnight. Note that this step will generate Cul1^AMC•Rbx1.
      CAUTION: Fluorescent dyes are sensitive to light, so avoid exposing them to ambient light during the protein and sample preparation as much as possible.
      NOTE: The protocol can be paused here.
   3. Add 50 µL of Ni-NTA agarose beads to the reaction mixture and incubate at room temperature for 30 min.
   4. Pellet the Ni-NTA agarose beads by centrifugation at 5,000 x g for 2 min and collect the supernatant.
   5. Equilibrate a size exclusion chromatography column (see Table of Materials) with buffer (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol) on the FPLC system.
   6. Load all the Cul1^AMC•Rbx1 sample on the size exclusion chromatography column. Elute with 1.5x column volume of buffer.
   7. Check the eluate fractions by SDS-PAGE²⁴.
   8. Pool the eluate fractions containing Cul1^AMC•Rbx1.
   9. Measure the protein concentration using its absorbance at 280 nm with a spectrophotometer.
   10. Aliquot the protein solution and store at -80 °C.
       NOTE: The protocol can be paused here.

3. Preparation of ^FlAsHCand1, the FRET acceptor protein

NOTE: Most of steps in this part are the same as Step 2. Conditions that differ are described in detail below.

1. Construct the plasmid for expressing human ^TetraCysCand1 in E. coli cells.
   1. Add DNA sequence coding “CCPGCCGSG” (tetracysteine/TetraCys tag) before the 15^th amino acid of Cand1 through regular PCR²⁵ (primer sequences: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
   2. Insert the PCR product into a pGEX-4T-2 vector. Sequence the plasmid to confirm the gene insert is accurate and in frame.
2. Express ^TetraCysCand1in E. coli cells in the same way as step 2.2, except that the plasmid is transformed into Rosetta competent cells.
3. Purification of ^TetraCysCand1 from the E. coli cells.
   1. Lyse the E. coli cell pellets and extract ^TetraCysCand1using glutathione beads. These steps are the same as steps 2.3.1–2.3.12.
   2. Dilute the protein eluate from the glutathione beads with Buffer C (50 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 7.5) by three folds. Equilibrate an anion exchange chromatography column (see Table of Materials) on the FPLC system with Buffer C and load the diluted protein sample at a 0.5 mL/min flow rate.
   3. Elute the protein with a gradient of NaCl in 40 mL by mixing Buffer C and 0 to 50% Buffer D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 7.5) at a 1 mL/min flow rate. Check the eluted protein in different fractions using SDS-PAGE²⁴, and pool the fractions containing ^TetraCysCand1. Note that ^TetraCysCand1 has a larger retention volume than free GST.
   4. Concentrate the pooled ^TetraCysCand1 sample by passing the buffer through an ultrafiltration membrane (30 kDa cutoff).
   5. Equilibrate the size exclusion chromatography column with labeling buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glycerol) on the FPLC system. Load ^TetraCysCand1 sample (500 µL each time) and check the eluate fractions by SDS-PAGE²⁴.
   6. Pool all the fractions containing ^TetraCysCand1 and concentrate the protein to ~40 µM by passing the buffer through an ultrafiltration membrane (30 kDa cutoff). Estimate the protein concentration using its absorbance at 280 nm. Store the protein as 50 µL aliquots at -80 °C.
      NOTE: The protocol can be paused here.
4. Preparation of ^FlAsHCand1.
   1. Add 1 µL of FlAsH solution (see Table of Materials) to 50 µL ^TetraCysCand1 solution.
   2. Mix well and incubate the mixture at room temperature in the dark for 1-2 h to get ^FlAsHCand1.
      NOTE: The protocol can be paused here.

4. Preparation of Cand1, the FRET chase protein

NOTE: The protein preparation protocol is similar to Step 3, with the following modifications.

1. Insert the coding sequence of full-length Cand1 into the pGEX-4T-2 vector.
2. Change the buffer used in step 3.3.5 to a buffer containing 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol.
3. Eliminate steps 3.3.7 and 3.3.8.

5. Test and confirm the FRET assay

1. Prepare the FRET buffer containing 30 mM Tris-HCl, 100 mM NaCl, 0.5 mM DTT, 1 mg/mL ovalbumin, pH 7.6, and use at room temperature.
2. Test the FRET between Cul1^AMC•Rbx1 and ^FlAsHCand1 on a fluorimeter.
   1. In 300 µL of FRET buffer, add Cul1^AMC•Rbx1 (FRET donor) to a final concentration of 70 nM. Transfer the solution into a cuvette.
   2. Place the cuvette in the sample holder of a fluorimeter. Excite the sample with 350 nm excitation light and scan the emission signals from 400 nm to 600 nm at 1 nm increments.
   3. Repeat step 5.2.1 but change Cul1^AMC•Rbx1 to ^FlAsHCand1 (FRET acceptor). Scan the ^FlAsHCand1 sample using the same method as in step 5.2.2.
   4. (Optional) Excite the ^FlAsHCand1 with 510 nm excitation light, and scan the emission signal from 500 nm to 650 nm.
   5. In 300 µL FRET buffer, add both Cul1^AMC•Rbx1 and ^FlAsHCand1 to a final concentration of 70 nM. Analyze the sample in the same way as in step 5.2.2.
3. Confirm the FRET between Cul1^AMC•Rbx1 and ^FlAsHCand1 by adding the chase (unlabeled Cand1) protein (Figure 3C).
   1. In 300 µL of FRET buffer, add 70 nM Cul1^AMC•Rbx1 and 700 nM Cand1. Scan the sample emission as in step 5.2.2.
   2. In 300 µL of FRET buffer, add 70 nM ^FlAsHCand1 and 700 nM Cand1. Scan the sample emission as in step 5.2.2.
   3. In 300 µL of FRET buffer, add 70 nM Cul1^AMC•Rbx1 and 70 nM ^FlAsHCand1, and incubate the sample at room temperature for 5 min. Then add 700 nM Cand1, and immediately after the addition, scan the sample emission as in step 5.2.2). Note that this step is similar to step 5.2.5.
   4. In 300 µL FRET buffer, sequentially add 70 nM Cul1^AMC•Rbx1, 700 nM Cand1, and 70 nM ^FlAsHCand1. Incubate the sample at room temperature for 5 min, and scan the sample emission as in step 5.2.2. Note that this is the chase sample (green line in Figure 3C).

6. Measure the association rate constant (k_on) of Cul1•Cand1

NOTE: Details of operating a stopped-flow fluorimeter has been described in a previous report²⁶.

1. Prepare the stopped-flow fluorimeter for measurement.
   1. Turn on the stopped-flow fluorimeter according to the manufacturer’s instruction.
   2. Set the excitation light at 350 nm, and use a band-pass filter that allows 450 nm emission light to pass and blocks 500-650 nm emission light.
   3. Keep the sample valves at the FILL position, and connect a 3 mL syringe filled with water. Wash the two sample syringes (A and B) with water by moving the sample syringe drive up and down several times. Discard all the water used in this step.
   4. Keep the sample valves at the FILL position, and connect a 3 mL syringe filled with FRET buffer. Wash the two sample syringes with the FRET buffer by moving the sample syringe drive up and down several time. Discard all the FRET buffer used in this step.
2. Take a control measurement (Figure 4C).
   1. Connect a 3 mL syringe and load Syringe A with 100 nM Cul1^AMC•Rbx1 in the FRET buffer. Turn the sample valve to the DRIVE position.
   2. Connect a 3 mL syringe and load Syringe B with the FRET buffer. Turn the sample valve to the DRIVE position.
   3. Use the Control Panel under Acquire in the software to take five shots (mix equal volume of samples from Syringe A and Syringe B) on the stopped-flow fluorimeter without recording the results.
   4. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 60 s. Then take a single shot.
   5. Repeat step 6.2.4 2x.
   6. Turn the sample valve to the FILL position. Empty Syringe B and wash with the FRET buffer.
3. Measure observed association rate constants (k_obs) of Cul1•Cand1 (Figure 4B).
   1. Keep the sample in Syringe A the same as in step 6.2.1.
   2. Connect a 3 mL syringe and load Syringe B with 100 nM ^FlAsHCand1 in the FRET buffer. Turn the sample valve to the DRIVE position.
   3. Use the Control Panel under Acquire in the software to take five shots without recording the results.
   4. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 60 s. Then take a single shot.
   5. Repeat step 6.3.4 2x.
   6. Empty Syringe B and wash with the FRET buffer.
   7. Repeat steps 6.3.1–6.3.6 several times with increasing concentrations of ^FlAsHCand1 in the FRET buffer.
   8. Fit the change (decrease) in fluorescent signals measured over time from each shot to a single exponential curve. This will give k_obs in each measurement, and the unit is s^-1. Note that the basis of this calculation has been well discussed in a previous report²⁷.
4. Calculate the average and standard deviation of k_obs for each ^FlAsHCand1 concentration used. Plot the average k_obs against Cand1 concentration (Figure 4D), and the slope of the line represents the k_on of Cul1•Cand1, with a unit of M^-1 s^-1.

7. Measure the dissociation rate constant (k_off) of Cul1•Cand1 in the presence of Skp1•F-box protein.

NOTE: This step is similar to Step 6, with the following modifications.

1. In Syringe A, under the FILL position, load a solution of 100 nM Cul1^AMC•Rbx1 and 100 nM ^FlAsHCand1 in the FRET buffer. Turn the sample valve to the “DRIVE” position.
2. In Syringe B, under the FILL position, load a solution of Skp1•Skp2 (prepared following a previous report²⁰). Turn the sample valve to the “DRIVE” position.
3. Open the Control Panel under Acquire in the software, and program to record the emission of Cul1^AMC over 30 s. Then take a single shot. The fluorescent signals increase over time after mixing solutions from Syringe A and Syringe B (Figure 5).

Results

To test the FRET between Cul1^AMC and ^FlAsHCand1, we first determined the emission intensity of 70 nM Cul1^AMC (the donor) and 70 nM ^FlAsHCand1 (the acceptor), respectively (Figure 3A-C, blue lines). In each analysis, only one emission peak was present, and the emission of ^FlAsHCand1 (the acceptor) was low. When 70 nM each of Cul1^AMC and ^FlAsHCand1 were mixed to genera...

Discussion

FRET is a physical phenomenon that is of great interest for studying and understanding biological systems¹⁹. Here, we present a protocol for testing and using FRET to study the binding kinetics of two interacting proteins. When designing FRET, we considered three major factors: the spectral overlap between donor emission and acceptor excitation, the distance between the two fluorophores, and the dipole orientation of the fluorophores²⁸. To choose the fluorophores for FRET, ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Anion exchange chromatography column	GE Healthcare	17505301	HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge	Eppendorf	2231000511
BL21 (DE3) Competent Cells	ThermoFisher Scientific	C600003
Calcium Chloride	Fisher Scientific	C78-500
Cation exchange chromatography column	GE Healthcare	17505401	HiTrap SP Sepharose FF
Desalting Column	GE Healthcare	17085101
Floor model centrifuge (high speed)	Beckman Coulter	J2-MC
Floor model centrifuge (low speed)	Beckman Coulter	J6-MI
Fluorescence SpectraViewer	ThermoFisher Scientific		https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter	HORIBA	FluoroMax-3
FPLC	GE Healthcare	29018224
GGGGAMC peptide	New England Peptide	custom synthesis
Glutathione beads	GE Healthcare	17075605
Glycerol	Fisher Scientific	G33-500
HEPES	Fisher Scientific	BP310-100
Isopropyl-β-D-thiogalactoside (IPTG)	Fisher Scientific	15-529-019
LB Broth	Fisher Scientific	BP1426-500
Ni-NTA agarose	Qiagen	30210
Ovalbumin	MilliporeSigma	A2512
pGEX-4T-2 vector	GE Healthcare	28954550
Protease inhibitor cocktail	MilliporeSigma	4693132001
Reduced glutathione	Fisher Scientific	BP25211
Refrigerated shaker	Eppendorf	M1282-0004
Rosetta Competent Cells	MilliporeSigma	70953-3
Size exclusion chromatography column	GE Healthcare	28990944	Superdex 200 10/300 GL column
Sodium Chloride (NaCl)	Fisher Scientific	S271-500
Stopped-flow fluorimeter	Hi-Tech Scientific	SF-61 DX2
TCEP·HCl	Fisher Scientific	PI20490
Thrombin	MilliporeSigma	T4648
Tris Base	Fisher Scientific	BP152-500
Ultrafiltration membrane	MilliporeSigma	UFC903008	Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL