Method Article

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

DOI:

10.3791/59218

April 4th, 2019

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide1. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly2. There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable eff....

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Material Preparation

  1. Purchase cell media (reduced serum media, minimum essential media [MEM], 10x MEM, and Dulbecco’s modified Eagle’s medium [DMEM]), transfection reagent, and microcrystalline cellulose (see Table of Materials).
  2. Obtain the following vectors for reverse genetics: the genomic vector(s) and the expression vectors encoding the N protein and the polymerase complex proteins. The genomic vectors contain the full cDNA genome of RSV-GFP (p-RSV-GFP) and of RSV-M2-1GFP (p-RSV-M2-1GFP) downstream from the bacteriophage T7 RNA polymerase (T7 pol) promoter. The expression vectors (designated as p-N, p-P, p-L, a....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this work, we described a detailed protocol to produce recombinant RSV viruses expressing a fluorescent protein (Figure 2). In pRSV-GFP, the GFP gene was introduced between the P and M genes, as described for the Cherry gene in previously published work21. In the pRSV-M2-1-GFP, the M2 gene was left untouched and an additional gene coding for M2-1-GFP was inserted between SH and G genes12. The first step, corr.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag12. RSV rescue is challenging and requires practice. The trans.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors thank Dr. Qin Yu from AstraZeneca R&D Boston, MA, USA, for providing the AZD4316 drug. The authors are grateful to the Cymages platform for access to the ScanR Olympus microscope, which was supported by grants from the region Ile-de-France (DIM ONE HEALTH). The authors acknowledge support from the INSERM and the Versailles Saint-Quentin University.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
35 mm µ dish for live cell imagingIbidi81156
A549ATCCATCC CCL-185
Avicel RC-591FMC BioPolymerAvicel RC-591Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.
BSRT7/5not commercially availableSee reference 22. Buchholz et al. 1999
Crystal violet solutionSigmaHT90132
Fluorescence microscope for observationsOlympusIX73 Olympus microscope
Fluorescence microscope for videomicroscopyOlympusScanR Olympus microscope
HEp-2ATCCATCC CCL-23
HEPES ≥99.5%SigmaH3375
L-Glutamine (200 mM)ThermoFisher Scientific25030024
LIPOFECTAMINE 2000 REAGENTThermoFisher Scientific11668019Protocol in step 2.3. is optimized for this reagent.
MEM (10x), no glutamineThermoFisher Scientific11430030
MEM, GlutaMAX SupplementThermoFisher Scientific41090-028
MgSO4 ReagentPlus, ≥99.5%SigmaM7506
Opti-MEM I Reduced Serum MediumThermoFisher Scientific51985-026
Paraformaldehyde Aqueous Solution, 32%, EM GradeElectron Microscopy Sciences15714
Penicillin-Streptomycin (10,000 U/mL)ThermoFisher Scientific15140122
Plasmidsnot commercially availableSee reference 21. Rameix-Welti et al. 2014
See Saw RockerVWR444-0341
Si RNA GAPDHDharmaconON-TARGETplus siRNA
D-001810-10-05
SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.
Si RNA IMPDH2DharmaconON-TARGETplus siRNA IMPDH2 Pool- Human
L-004330-00-0005
SMARTpool of 4 individual siRNAs designed by Dharmacon.
Individual references and sequences
J-004330-06: GGAAAGUUGCCCAUUGUAA;
J-004330-07: GCACGGCGCUUUGGUGUUC;
J-004330-08: AAGGGUCAAUCCACAAAUU;
J-004330-09: GGUAUGGGUUCUCUCGAUG;
Si RNA RSV NDharmaconON-TARGETplus custom siRNAUUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA
SiRNA NTDharmaconON-TARGETplus Non-targeting Pool
SiRNA transfection reagentDharmaconDharmaFECT 1 Ref: T-2001-03Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.
Sodium Bicarbonate 7.5% solutionThermoFisher Scientific25080094
SpectrofluorometerTecanTecan infinite M200PRO

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Shi, T., et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study. The Lancet. 390 (10098), 946-958 (2017).
  2. Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C., Walsh, E. E.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Recombinant Respiratory Syncytial VirusReverse Genetics SystemViral Stock AmplificationPlaque Titration AssayBSR T7 5 CellsHEp 2 Cell InfectionGFP Fluorescence TrackingMicrocrystalline Cellulose OverlayViral Harvesting FreezingPlaque Forming Units

Related Articles