A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

7.3K views

⸱

DOI:

10.3791/59549

⸱

May 2nd, 2019

In This Article

Summary

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

Abstract

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously ‘undruggable’ hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (< pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Introduction

Because siRNAs inhibit the translation of proteins from mRNA sequences, they can theoretically be used to drug all known pathologies1,2,3,4,5. However, the use of siRNA in medicine is limited by the comprehensively poor pharmacokinetic profile of siRNA molecules6,7. When injected intravenously, siRNAs are rapidly cleared through the kidneys and/or degraded by nucleases8,9. Due to its large s....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparation and characterization of si-NPs

  1. si-NP preparation
    1. Dissolve polymer in 10 mM citric acid buffer (pH 4.0) at 3.33 mg/mL. Polymer can first be dissolved at 10x concentration in ethanol to ensure dissolution.
      NOTE: Polymer can be dissolved at lower concentrations, but use at concentrations above 3.33 mg/mL can prevent homogenous NP formation.
    2. Add siRNA (50 μM in diH2O) to result in N+:P- ratio of 10. Mix polymer and siRNA solutions thoroughly by pipetting and let incubate for 30 min. The N+:P- ratio represents the number of positively-charged amine groups on the p....

Access restricted. Please log in or start a trial to view this content.

Results

Some essential characteristics of effective si-NPs for in vivo siRNA delivery are the proper size (~20 – 200 nm diameter), siRNA packaging, and gene silencing bioactivity. While this is not an exhaustive list (as addressed in the Discussion), these basic characteristics should be confirmed before considering further testing of a formulation.

Figure 2 illustrates the characterization of si-NP size an.......

Access restricted. Please log in or start a trial to view this content.

Discussion

The si-NPs described here are formed by electrostatic association of anionic siRNA and cationic polymers into polyion complexes (polyplexes). Electrostatic complexing of siRNA and the cationic DB block of PEG-DB polymers is facilitated by mixing at low pH (4.0). At pH 4.0, DMAEMA is highly protonated, and consequently the DB block is highly charged. This ensures that the polymers dissolve as unimers in solution as opposed to forming micelles and that DB complexes efficiently with siRNA. Subsequently, the pH of solution i.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors disclose no potential conflicts of interest.

Acknowledgements

The authors are grateful to Drs. Craig Duvall and Rebecca Cook for access to data and lab resources for conducting this research. The authors are grateful to the Vanderbilt Institute for Nanoscale Science and Engineering (VINSE) for access to DLS and TEM (NSF EPS 1004083) instruments. The authors are grateful to the National Science Foundation for supporting the Graduate Research Fellowship Program (NSF#1445197). The authors are grateful to the National Institutes of Health for financial support (NIH R01 EB019409). The authors are grateful to the Department of Defense Congressionally Directed Medical Research program for financial support (DOD CDMRP OR130302).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.45 μm pore-size syringe filtersThermo Fisher ScientificF2513317 mm diameter, PTFE membrane
0-14 pH test stripsMillipore SigmaP4786
10x TAE bufferThermo Fisher Scientific/InvitrogenAM9869
6-7.7 pH test stripsMillipore SigmaP3536
96-well black walled platesCorning3603Tissue-culture treated
Agarose PowderThermo Fisher Scientific/Invitrogen16500
Citric acid monohydrateMillipore SigmaC1909
dibasic sodium phosphate dihydrateMillipore Sigma71643
D-luciferinThermo Fisher Scientific88294Monopotassium Salt
DMEMGibco11995065High glucose and pyruvate
EthanolMillipore Sigma459836
ethidium bromideThermo Fisher Scientific/Invitrogen15585011
FBSGibco26140079
loading dyeThermo Fisher Scientific/InvitrogenR0611
Luciferase siRNAIDTN/AAntisense Strand Sequense: GAGGAGUUCAUUAUCAGUGC
AAUUGUU
Sense Strand Sequense: CAAUUGCACU
GAUAAUGAACUCCT*C* *DNA bases
MDA-MB-231 / Luciferase (Bsd) stable cellsGenTarget IncSC059-BsdLuciferase-expressing cells sued to assess si-NP bioactivity
monobasic sodium phosphate monohydrateMillipore SigmaS9638
Scarmbled siRNAIDTN/AAntisense Strand Sequense: AUACGCGUAUU
AUACGCGAUUAACGAC
Sense Strand Sequense: CGUUAAUCGCGUAUAAUAC
GCGUA*T* *DNA bases
square polystyrene cuvettesFisher Scientific14-955-1294.5 mL capacity
TEM gridsTed Pella, Inc.1GC50PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper
Trisodium citrate dihydrateMillipore SigmaS1804
uranyl acetatePolysciences, Inc.21447-25

References

  1. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391 (6669), 806-811 (1998).
  2. Elbashir, S. M., et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mam....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Dynamic Light ScatteringTransmission Electron MicroscopyAgarose Gel RetardationEndosomal EscapepH-responsive PolymerCytosolic DeliveryGene Silencing Assay