A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Droplet Digital TRAP (ddTRAP): Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

8.3K views

DOI:

10.3791/59550

May 3rd, 2019

In This Article

Summary

We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

Abstract

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.

Introduction

Telomeres are dynamic DNA-protein complexes at the ends of linear chromosomes. Human telomeres are composed of an array of 5'-TTAGGGn hexameric repeats which vary in length between 12–15 kilobases (kb) at birth1. Human telomerase, the ribonucleoprotein enzyme that maintains the telomeres, was first identified in HeLa cell lysates (cancer cell line)2. Together, telomeres and telomerase play a major role in a spectrum of biological processes such as genome protection, gene regulation, and cancer cell immortality3,4,....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Buffer preparation and storage

  1. Prepare 50 mL of 1x stock RNase-/DNase-free NP-40 lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% [vol/vol] NP-40, 10% [vol/vol] glycerol, 150 mM NaCl, 5 mM β-mercaptoethanol, and 0.1 mM 4-benzenesulfonyl fluoride hydrochloride (AEBSF)). This buffer can be aliquoted and stored at -20 °C for future use. Avoid freeze/thaw cycles in order to obtain an optimal lysis of cells.
  2. Prepare 50 mL of 10x stock RNase-/DNase-free TRAP extension buffer (200 mM Tris-HCl [pH 8.0], 15 mM MgCl2, 630 mM KCl, 0.5% [vol/vol] Tween 20, and 10 mM ethylene....

Access restricted. Please log in or start a trial to view this content.

Results

Using the ddTRAP, telomerase activity was measured in a cell panel consisting of the following cell lines (Figure 1): nonsmall cell lung cancer (H2882, H1299, Calu6, H920, A549, and H2887), small cell lung cancer (H82 and SHP77), and telomerase-negative fibroblasts (BJ). One million cell pellets were lysed in NP-40 buffer, and telomerase extension reactions were performed in biological triplicates. A common and highly recommended negative control is the “NTC”.......

Access restricted. Please log in or start a trial to view this content.

Discussion

The measurement of telomerase activity is critical to a plethora of research topics including, but not limited to, cancer, telomere biology, aging, regenerative medicine, and structure-based drug design. Telomerase RNPs are low abundant, even in cancer cells, making the detection and study of this enzyme challenging. In this paper, we described the step-by-step procedures for the newly developed ddTRAP assay to robustly quantify telomerase activity in cells. By combining the traditional telomerase extension reaction with.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors would like to acknowledge funding sources from the National Institutes of Health (NIH) (NCI-R00-CA197672-01A1). Small cell lung cancer lines (SHP77 and H82) were a generous gift from Drs. John Minna and Adi Gazdar from the UT Southwestern Medical Center.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1 M Tris-HCl pH 8.0AmbionAM9855GRNAse/DNAse free
1 M MgCl2AmbionAM9530GRnAse/DNAse free
0.5 M EDTA pH 8.0AmbionAM9261RNAse/DNAse free
Surfact- Amps NP-40Thermo Scientific28324
100% Ultrapure GlycerolInvitrogen15514011RNAse/DNAse free
phenylmethylsulfonyl fluorideThermo Scientific36978Powder
2-MercaptoethanolSIGMA-ALDRICH516732
Nuclease Free H20AmbionAM9932RNAse/DNAse free
2.5 mM dNTP mixThermo ScientificR725012.5 mM of each dATP, dCTP, dGTP and dTTP
2 M KClAmbionAM9640GRNAse/DNAse free
100% Tween-20Fisher9005-64-5
0.5 M EGTA pH 8.0Fisher50-255-956RNAse/DNAse free
Telomerase Substrate (TS) PrimerIntegrated DNA Technology (IDT)Custom Primer (HPLC Purified)5'- AATCCGTCGAGCAGAGTT-3'
ACX (Revers) PrimerIntegrated DNA Technology (IDT)Custom Primer (HPLC Purified)5'- GCGCGGCTTACCCTTACCCTTACCCTAACC -3'
Thin walled (250 ul) PCR grade tubesUSA Scientific1402-2900strips, plates, tubes etc.
QX200 ddPCR EvaGreen SupermixBio Rad1864034
Twin-Tec 96 Well PlateFisherEppendorf 951020362
Piercable foil heat sealBio Rad1814040
Droplet generator cartidges (DG8)Bio Rad1863008
Droplet generator oilBio Rad1863005
Droplet generator gasketBio Rad1863009
96-well Thermocycler T100Bio Rad1861096
PX1 PCR Plate SealerBio Rad1814000
QX200 Droplet Reader and Quantasoft SoftwareBio Rad1864001 and 1864003
ddPCR Droplet Reader OilBio Rad1863004
Nuclease Free Filtered Pipette TipsThermo Scientific10 ul, 20 ul , 200 ul and 1000 ul

References

  1. Frenck, R. W. Jr, Blackburn, E. H., Shannon, K. M. The rate of telomere sequence loss in human leukocytes varies with age. Proceedings of the National Academy of Sciences of the United States of America. 95 (10), 5607-5610 (1998).
  2. Morin, G. B.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Telomerase Activity AssayCell Lysate PreparationNP 40 Lysis BufferPMSF Protease InhibitorTelomerase Extension ReactionDroplet Generation OilQX200 ddPCR EvaGreen