Method Article

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

5.9K views

DOI:

10.3791/59635

August 9th, 2019

In This Article

Summary

Sequence specificity is critical for gene regulation. Regulatory proteins that recognize specific sequences are important for gene regulation. Defining functional binding sites for such proteins is a challenging biological problem. An iterative approach for identification of a binding site for an RNA-binding protein is described here and is applicable to all RNA-binding proteins.

Abstract

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational steps are used to regulate specific genes. Sequence-specific nucleic acid-binding proteins target specific sequences to control spatial or temporal gene expression. The binding sites in nucleic acids are typically characterized by mutational analysis. However, numerous proteins of interest have no known binding site for such characterization. Here we describe an approach to identify previously unknown binding sites for RNA-binding proteins. It involves iterative selection and amplification of sequences starting with a randomized sequence pool. Following several rounds of these steps-transcription, binding, and amplification-the enriched sequences are sequenced to identify a preferred binding site(s). Success of this approach is monitored using in vitro binding assays. Subsequently, in vitro and in vivo functional assays can be used to assess the biological relevance of the selected sequences. This approach allows identification and characterization of a previously unknown binding site(s) for any RNA-binding protein for which an assay to separate protein-bound and unbound RNAs exists.

Introduction

In cell biology, gene regulation plays a central role. At one or multiple steps along the gene expression pathway, genes have the potential to be regulated. These steps include transcription (initiation, elongation, and termination) as well as splicing, polyadenylation or 3’ end formation, RNA export, mRNA translation, and decay/localization of primary transcripts. At these steps, nucleic acid-binding proteins modulate gene regulation. Identification of binding sites for such proteins is an important aspect of studying gene control. Mutational analysis and phylogenetic sequence comparison have been used to discover regulatory sequences or protein-binding sites i....

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: Figure 1 provides a summary of key steps in the iterative selection-amplification (SELEX) process.

1. Generation of a random library template

  1. Synthesize the forward primer 5’- GTAATACGACTCACTATAGGGTGATCAGATTCTGATCCA-3’ and the reverse primer 5’- GCGACGGATCCAAGCTTCA-3’ by chemical synthesis on a DNA synthesizer.
    NOTE: The primers and the random library can be synthesized commercially.
  2. Synthesize a random library oligonucleotide template 5’- GGTGATCAGATTCTGATCCA(N1…N31)TGAAGCTTGGATCCGTCGC-3....

Access restricted. Please log in or start a trial to view this content.

Results

The following observations demonstrate successful selection-amplification (SELEX). First, we analyzed pool 0 and the selected sequences for binding to the protein used for the iterative selection-amplification approach. Figure 2 shows that the mammalian polypyrimidine-tract binding protein (PTB) shows barely detectable binding to the pool 0 sequence but high affinity for the selected sequence pool. There was barely detectable binding to pool 0 when we used ab.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Nucleic acid-binding proteins are important regulators of animal and plant development. A key requirement for the SELEX procedure is the development of an assay that can be used to separate protein-bound and unbound RNA fractions. In principle, this assay can be an in vitro binding assay such as the filter-binding assay, the gel mobility shift assay, or a matrix binding assay19 for recombinant proteins, purified proteins, or protein complexes. The assay can also be an enzymatic assay where the pre.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The author declares that he has no competing financial interests.

Acknowledgements

The author thanks the National Institutes of Health for the past funding.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Gel Electrophoresis equipmentStandardStandard
Glass PlatesStandardStandard
NitrocelluloseMilliporeHAWP
NitrocelluloseSchleicher & SchuellPROTRAN
polyacrylamide gel solutionsStandardStandard
Proteinase KNEBP8107S
Recombinant PTBLaboratory PreparationNot applicable
Reverse TranscriptaseNEBM0277S
Vacuum manifoldFisher ScientificXX1002500Millipore 25mm Glass Microanalysis Vacuum Filter
Vacuum manifoldMilliporeXX27025521225 Sampling Vacuum Manifold
X-ray filmsStandardStandard

References

  1. Pribnow, D. Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. Proceedings of the National Academy of Sciences of the United States of America. 72 (3), 784-788 (1975).
  2. Breathnach, R., Chambon, P.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Sequence Space ExplorationBinding Site IdentificationRandomized Sequence PoolSelection AmplificationFilter Binding AssayGel Mobility ShiftProtein RNA BindingTranscription TranslationFunctional Assays

Related Articles