A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

In Vesiculo Synthesis of Peptide Membrane Precursors for Autonomous Vesicle Growth

5.2K views

⸱

DOI:

10.3791/59831

⸱

June 28th, 2019

In This Article

Summary

Presented here are protocols for the creation of peptide-based small unilamellar vesicles capable of growth. To facilitate in vesiculo production of the membrane peptide, these vesicles are equipped with a transcription-translation system and the peptide-encoding plasmid.

Abstract

Compartmentalization of biochemical reactions is a central aspect of synthetic cells. For this purpose, peptide-based reaction compartments serve as an attractive alternative to liposomes or fatty acid-based vesicles. Externally or within the vesicles, peptides can be easily expressed and simplify the synthesis of membrane precursors. Provided here is a protocol for the creation of vesicles with diameters of ~200 nm based on the amphiphilic elastin-like polypeptides (ELP) utilizing dehydration-rehydration from glass beads. Also presented are protocols for bacterial ELP expression and purification via inverse temperature cycling, as well as their covalent functionalization with fluorescent dyes. Furthermore, this report describes a protocol to enable the transcription of RNA aptamer dBroccoli inside ELP vesicles as a less complex example for a biochemical reaction. Finally, a protocol is provided, which allows in vesiculo expression of fluorescent proteins and the membrane peptide, whereas synthesis of the latter results in vesicle growth.

Introduction

The creation of synthetic living cellular systems is usually approached from two different directions. In the top-down method, the genome of a bacterium is reduced to its essential components, ultimately leading to a minimal cell. In the bottom-up approach, artificial cells are assembled de novo from molecular components or cellular subsystems, which need to be functionally integrated into a consistent cell-like system.

In the de novo approach, compartmentalization of the necessary biochemical components is usually achieved using membranes made from phospholipids or fatty acids1,2,3,4. This is because "modern" cell membranes mainly consist of phospholipids, while fatty acids are regarded plausible candidates of prebiotic membrane enclosures5,6. For the formation of new membranes or to facilitate membrane growth, amphiphilic building blocks must be provided from the exterior7 or ideally through production within a membranous compartment using the corresponding anabolic processes4,8.

While lipid synthesis is a relatively complex metabolic process, peptides can be produced quite readily using cell-free gene expression reactions9,10. Hence, peptide membranes formed by amphiphilic peptides represent an interesting alternative to lipid membranes as enclosures for artificial cell mimics that are able to grow11.

Amphiphilic elastin-like di-block copolymers (ELPs) are an attractive class of peptides, which can serve as the building block for such membranes12. The basic amino acid sequence motif of ELPs is (GaGVP)n, where “a” can be any amino acid except for proline and “n” is the number of motif repeats13,14,15,16,17. ELPs have been created with a hydrophobic block containing mainly phenylalanine for a and a hydrophilic block mainly composed of glutamic acid11. Depending on a and solution parameters, such as pH and salt concentration, ELPs exhibit a so-called inverse temperature transition at temperature Tt, where the peptides undergo a fully reversible phase transition from a hydrophilic to hydrophobic state. The synthesis of the peptides can be easily implemented inside vesicles using the “TX-TL” bacterial cell extract11,18,19,20,21, which provides all necessary components for coupled transcription and translation reactions.

The TX-TL system was encapsulated together, with the DNA template encoding the ELPs into ELP vesicles utilizing dehydration-rehydration from glass beads as a solid support. The formation of vesicles occurs through rehydration of the dried peptides from the bead surface11. Other methods22 for vesicle formation can be used, which potentially show lower polydispersity and larger vesicle sizes (e.g., electro-formation, emulsion phase transfer, or microfluidics-based methods). To test the viability of the encapsulation method, transcription of the fluorogenic aptamer dBroccoli23 can alternatively be used11, which is less complex than gene expression with the TX-TL system.

Due to the expression of the membrane building blocks in vesiculo and their subsequent incorporation into the membrane, the vesicles start to grow11. Membrane incorporation of the ELPs can be demonstrated through a FRET assay. To this end, the ELPs used for formation of the initial vesicle population are be conjugated with fluorescent dyes in equal shares constituting a FRET pair. Upon expression of non-labeled ELPs in vesiculo and their incorporation into the membrane, the labeled ELPs in the membrane are diluted and consequently the FRET signal decreases11. As a versatile and common method for conjugation, copper catalyzed azide-alkyne cycloaddition is used. With the use of a stabilizing ligand such as tris(benzyltriazolylmethyl)-amine, the reaction can be carried out in an aqueous solution at a physiological pH without the hydrolysis of reactants11, which is appropriate for conjugation reactions involving peptides.

The following protocol presents a detailed description of the preparation for growing ELP-based peptidosomes. The expression of the peptides and vesicle formation using the glass beads method are described. Furthermore, it is described how to implement transcription of the fluorogenic dBroccoli aptamer and the transcription-translation reaction for protein expression inside the ELP vesicles. Finally, provided is a procedure for the conjugation of ELPs with fluorophores, which can be used to prove vesicle growth through a FRET assay11.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Expression of Elastin-like Polypeptides

  1. Day 1: Preparation of a starter culture and supplies for peptide expression
    1. Prepare and autoclave expression culture flasks (4 x 2.5 L) and 3 L of LB medium. For 1 L of LB medium, add 25 g of LB powder to 1 L of ultrapure water.
    2. Prepare a starter culture with 100 mL of LB medium, 50 µL of sterile-filtered (0.22 µm filter) chloramphenicol solution (25 mg/mL in EtOH), and 50 µL of sterile-filtered (0.22 µm filter) carbenicillin solution (100 mg/mL in 50% EtOH and 50% ultrapure water).
    3. Add a small streak from a pre-made bacterial stock containing E. coli strain BL21(DE3)pLysS with the pET20b(+) expression vector encoding the polypeptide sequence MGHGVGVP((GEGVP)4(GVGVP))4((GFGVP)4(GVGVP))3(GFGVP)4GWP (abbreviated as EF) to a pre-warmed 100 mL starter culture and incubate at 37 °C for 16 h with 250 rpm in a shaking incubator (E. coli strains and vectors are available upon request).
    4. Pre-warm the expression culture flasks and the LB media at 37 °C overnight so that they are prepared for the next day.
  2. Day 2: Protein expression
    1. Add 750 mL of LB medium to each expression culture flask, 375 µL of sterile-filtered (0.22 µm filter) chloramphenicol stock (25 mg/mL in EtOH), and 375 µL of sterile-filtered (0.22 µm filter) carbenicillin stock (100 mg/mL in 50% EtOH and 50% ultrapure water).
    2. After agitation to distribute the antibiotics, take 2 mL of the media as a reference sample for the optical density measurement at 600 nm (OD600).
    3. Add 7.5 mL of the starting culture to the expression flask and incubate for 1 h at 37 °C with 250 rpm.
    4. After this step the OD600 of each flask will be checked every 20 min.
    5. When the optical density reaches approximately 0.8 reduce the temperature to 16 °C and induce peptide expression by adding 750 µL of 1 M sterile-filtered β-isopropyl thiogalactoside (IPTG) in ultrapure water into each expression flask.
    6. Incubate the expression flask with the induced bacteria at 16 °C for 16 h with 250 rpm.
  3. Day 3: Extraction of the expressed polypeptide
    1. Pre-weigh the centrifugation flask to enable determination of the mass of the cell pellet after harvesting.
    2. Harvest all the bacteria from the expression flasks by centrifugation for 20 min using a pre-cooled centrifuge at 4,000 x g and 4 °C.
    3. Pour out the supernatant and blot the centrifuge bottles on a sterile paper towel.
    4. Weigh the centrifugation flasks and calculate the cell pellet mass.
    5. Resuspend the cells, which are pelleted down from 750 mL of original cell culture, in 15 mL of phosphate-buffered saline (PBS, pH 7.4) by pipetting, and centrifuge at 4,000 x g for 20 min at 4 °C. Pour out the supernatant and blot the centrifuge bottles on a sterile paper towel.
    6. Resuspend the cell pellet for the lysis step in 2 mL of buffer per 1 gram of cell pellet using PBS (pH 7.4) supplemented with lysozyme (1 mg/mL), 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM benzamidine, and 0.5 U of DNase I.
    7. Sonicate the cells for further lysis on ice with a sonicator at 8 W for 9 min with alternating 10 s sonication and 20 s pausing steps, followed by a 9 min pause during which the sample should be cooled on ice. Repeat the 9 min sonication step once more.
    8. Add 2 mL of 10% (w/v) polyethyleneimine (PEI) per 1 L of original cell culture for nucleic acid precipitation.
    9. Distribute the sample into 2 mL centrifuge tubes and incubate at 60 °C for 10 min followed by an incubation for 10 min at 4 °C.
    10. Centrifuge the solution at 16,000 x g for 10 min at 4 °C and collect the supernatant containing the ELP.
  4. Protein purification via inverse temperature cycling:
    1. Adjust the supernatant to a pH of 2 to switch the hydrophilic part of the peptide to hydrophobic and induce aggregation. To adjust the pH, phosphoric acid and sodium hydroxide are used. pH stripes are sufficient to determine the pH level.
    2. To improve the yield of the purification the sample, heat the sample to 60 °C and add sodium chloride up to 2 M.
    3. Subsequently, centrifuge the sample at 16,000 x g for 10 min at room temperature (RT).
    4. Discard the supernatant and re-dissolve the pellet in PBS (but only half of the initial volume is used compared to the previous step).
    5. Adjust the pH to 7 with phosphoric acid and sodium hydroxide. pH stripes are sufficiently accurate to determine the pH.
    6. Centrifuge the sample subsequently at 16,000 x g for 10 min at 4 °C.
    7. Collect the supernatant and repeat steps 1.4.1–1.4.6 up to 3x total, except that in the last repetition of step 1.4.4, only water is added instead of PBS.
    8. Measure the concentration of the peptides with an absorption spectrometer. Use an extinction coefficient of 5500/M/cm at 280 nm.
    9. Adjust the concentration of the ELP to 700 µM.

2. Vesicle Production Using the Glass Beads Method

  1. Concentrate the ELP solution to 1.1 mM using a centrifugal vacuum concentrator.
  2. Mix 200 µL of the concentrated ELP solution with 1,250 µL of a 2:1 chloroform/methanol mixture followed by vortexing.
  3. Add 1.5 g of spherical glass beads (212–300 µm in size) to a 10 mL round bottom flask.
  4. Add the solution containing ELP and the chloroform/methanol mixture to the round bottom flask and mix by gentle shaking.
  5. Connect the flask to a rotary evaporator. Adjust the speed to 150 rpm and regulate the pressure to -0.2 x 105 Pa (-200 mbar) for approximately 4 min until the liquid is evaporated at room temperature.
  6. Place the round bottom flask into a desiccator for at least 1 h to ensure that remaining chloroform and methanol are evaporated. To avoid loss of the glass beads, loosely attached aluminum foil should be wrapped around the round bottom flask opening.
  7. For a single experiment, mix 100 mg of the peptide covered glass beads with 60 µL of the swelling solution, such as PBS. Incubate this sample at 25 °C for 5 min.
  8. Centrifuge the sample quickly with a table-top centrifuge to sediment the glass beads.
  9. Use a pipette to collect the supernatant which contains the vesicles.

3. Transcription of RNA Aptamer dBroccoli Inside the Vesicles

  1. Clean the lab bench with wipes containing RNase decontamination solution to create an RNase-free working environment.
  2. Mix the ssDNA (5 µM) comprising the T7 promotor and dBroccoli sequence (GAGACGGTCGGGTCCATCTGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCAGATGTCGAGTAGAGTGTGGGCTC), as well as the noncoding strand (5 µM) in nuclease-free water supplemented with RNAPol reaction buffer [40 mM Tris-HCl (pH = 7.9), 6 mM MgCl2, 1 mM dithiothreitol (DTT), and 2 mM spermidine], to prepare the DNA template for the transcription reaction.
  3. Incubate the solution at 90 °C for 5 min followed by a slow temperature decrease to 20 °C for 30 min.
  4. Prepare a 1 mM (5Z)-5-(3,5-difluoro-4-hydroxybenzylidene)-2,3-dimethyl-3,5-dihydro-4H-imidazol-4-one (DFHBI) solution by dissolving 1.26 mg of DFHBI in 5 mL of DMSO.
  5. Prepare the transcription reaction by mixing RNAPol reaction buffer [40 mM Tris-HCl (pH = 7.9), 6 mM MgCl2, 1 mM dithiothreitol (DTT), and 2 mM spermidine] with 125 mM KCl, 15 mM MgCl2, 4 mM rNTP, 10 µM DFHBI, 200 nM DNA template, 0.5 U/µL RNase inhibitor murine, and water.
  6. Right before the reaction is started, add 4 U/µL T7 polymerase.
  7. Use this reaction mix as the swelling solution in step 2.7 and incubate at 37 °C for the duration of the experiment, which is typically 1 h.

4. Transcription-translation (TX-TL) Reaction

NOTE: For the transcription-translation reaction, a crude cell extract is required as well as reaction buffer and DNA. The crude cell extract is prepared as described in Sun et al.18. For a TX-TL reaction, use the following: 33% (v/v) of the crude E. coli extract, 42% (v/v) reaction buffer, and 25% (v/v) phenol-chloroform purified DNA plus additives. The final concentrations are approximately 9 mg/mL protein, 50 mM HEPES (pH = 8), 1.5 mM ATP, 1.5 mM GTP, 0.9 mM CTP, 0.9 mM UTP, 0.2 mg/mL tRNA, 26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 68 mM folinic acid, 1 mM spermidine, 30 mM PEP, 1 mM DTT, 2% PEG-8000, 13.3 mM maltose, 1 U of T7 RNA polymerase, and 50 nM plasmid DNA in ultrapure water.

  1. Phenol-chloroform purification of the DNA template
    1. Prepare six overnight cultures with 5 mL of LB medium and 5 µL of sterile-filtered (0.22 µm filter) carbenicillin solution (100 mg/mL in 50% EtOH and 50% ultrapure water).
    2. Add a small streak from a pre-made bacterial stock containing DH5α E. coli with the pET20b(+) expression vector to each pre-warmed 5 mL overnight culture and incubate at 37 °C for 16 h with 250 rpm. Depending on which peptide (EF) or protein (YPet or mVenus) is to be expressed, a specific encoding plasmid is used.
    3. Extract the plasmid with a mini-prep kit as described in the user manual or by following the protocol provided by Zhang et al.24.
    4. Prepare 100 µL of the pre-purified plasmid DNA (concentration can range from 200–600 ng/µL) and mix with 100 µL of Roti-phenol/chloroform/isoamyl alcohol (pH = 7.5–8.0) in a microcentrifuge tube to enable better phase separation.
    5. Gently invert the tube up to 6x and centrifuge for 5 min at 16,000 x g at RT.
    6. Add 200 µL of chloroform to the upper phase of the tube and invert the tube up to 6x.
    7. Centrifuge the sample at 16,000 x g for 5 min at RT.
    8. Pipet the supernatant to a separate tube and add 10 µL of 3 M of sodium acetate for ethanol precipitation.
    9. Add 1 mL of -80 °C cold ethanol and store the sample at -80 °C for 1 h.
    10. Centrifuge the sample at 16,000 x g for 15 min at 4 °C.
    11. Decant the supernatant and add 1 mL of -20 °C cold 70% (v/v) ethanol.
    12. Centrifuge at 16,000 x g for 5 min at 4 °C.
    13. Remove the liquid by pipetting. Be careful to not disturb the DNA pellet.
    14. Store the sample at RT for approximately 15 min to evaporate the remaining ethanol.
    15. Add ultrapure water to the sample to adjust the sample concentration to approximately 300 nM, which is measured by absorption at 260 nm.
  2. Preparation of the TX-TL reaction
    1. Thaw the prepared crude cell extract and the reaction buffer on ice.
    2. For a 60 µL reaction mix, add the plasmid DNA (phenol-chloroform purified) to 37.5 µL of the reaction buffer [50 mM HEPES (pH = 8), 1.5 mM ATP, 1.5 mM GTP, 0.9 mM CTP, 0.9 mM UTP, 0.2 mg/mL tRNA, 26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 68 mM folinic acid, 1 mM spermidine, 30 mM PEP, 1 mM DTT, 2% PEG-8000, and 13.3 mM maltose), followed by the addition of 28.7 µL of crude cell extract. Fill to a final volume with ultrapure water to 58.8 µL.
    3. Right before the reaction starts, add 1.2 µL of the T7 RNA polymerase solution and mix the sample by pipetting up and down.
    4. Use this reaction mix as a swelling solution in step 2.7 and incubate at 29 °C for the duration of the experiment, which is typically 4–8 h.

5. Conjugation of Elastin-like Polypeptides with Fluorophores via Copper Catalyzed Azide-alkyne Huisgen Cycloaddition

  1. Prepare a 20 mM NHS-azide linker (γ-azidobutyric acid N-hydroxysuccinimide ester) solution in DMSO.
  2. Mix 250 µL of the ELP solution (600 µM) with PBS (8 g/L NaCl, 0.2 g/L KCl, 1.42 g/L Na2HPO4, 0.27 g/L K2HPO4, pH = 7.2) and NHS-azide (1.2 mM) and incubate for 12 h at RT.
  3. Load the sample in a 10 kDa dialysis cassette and store it at 4 °C for 12 h in 1 L of ultrapure water to remove the salts and residual NHS-azide.
  4. Mix the activated ELP (500 µM) with the alkyne-conjugated dye (500 µM), Cy5-alkyne, or Cy3-alkyne.
  5. Mix this sample with 1 mM TBTA (tris(benzyltriazolylmethyl)amine), 10 mM TCEP (tris(2-carboxyethyl)-phosphine hydrochloride) and 10 mM CuSO4 and incubate at 4 °C for 12 h.
  6. Load the sample in a 10 kDa dialysis cassette and store it at 4 °C for 12 h in 1 L of ultrapure water, to remove the salts and residual alkyne-conjugated dyes.
  7. These dye-modified ELPs are used in a 1:1 mixture of the Cy3 labeled ELPs and the Cy5 labeled ELPs analogous to the peptides in part two.

Access restricted. Please log in or start a trial to view this content.

Results

Vesicle production
Figure 1 shows transmission electron microscopy (TEM) images of vesicles prepared with different swelling solutions and the glass beads method (also see Vogele et al.11). For the sample in Figure 1A, only PBS was used as swelling solution to prove the formation of vesicles and to determine their size. When TX-TL was used as swelling solution (Figure 1B), the vesicles al...

Access restricted. Please log in or start a trial to view this content.

Discussion

Film rehydration is a common procedure for the creation of small unilamellar vesicles. The main source of failure is the wrong handling of the materials used in the procedure.

Initially, the ELPs are produced by E. coli cells. The yield after ELP purification can vary significantly depending on how carefully the protocol is conducted during its crucial steps. These are the inverse temperature cycling (ITC) step and th...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing financial interests.

Acknowledgements

We gratefully acknowledge financial support through the DFG TRR 235 (Emergence of Life, project P15), the European Research Council (grant agreement no. 694410 AEDNA), and the TUM International Graduate School for Science and Engineering IGSSE (project no. 9.05). We thank E. Falgenhauer for her help with sample preparation. We thank A. Dupin and M. Schwarz-Schilling for their help with the TX-TL system and useful discussions. We thank N. B. Holland for useful discussions.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
2xYTMP biomedicals3012-032
3-PGASigma-AldrichP8877
5PRIME Phase Lock GelTM tubeVWR733-2478
alkine-conjugated Cy3Sigma-Aldrich777331
alkine-conjugated Cy5Sigma-Aldrich777358
ATPSigma-AldrichA8937
BenzamidinCarl RothCN38.2
BL21 Rosetta 2 E. coli strainNovagen71402
Bradford BSA Protein Assay KitBio-rad500-0201
cAMPSigma-AldrichA9501
CarbenicillinCarl Roth6344.2
ChloramphenicolSigma-AldrichC1919
ChloramphenicolCarl Roth3886.3
ChloroformCarl Roth4432.1
CoASigma-AldrichC4282
CTPUSB14121
CuSO4Carl RothP024.1
DFHBILucerna Technologies410
DMSOCarl RothA994.1
DNase INEBM0303S
DTTSigma-AldrichD0632
EthanolCarl Roth9065.2
Folinic acidSigma-AldrichF7878
Glass beads, acid-washedSigma-AldrichG1277
GTPUSB16800
HEPESSigma-AldrichH6147
IPTG (β-isopropyl thiogalactoside )Sigma-AldrichI6758
KClCarl RothP017.1
K-glutamateSigma-AldrichG1149
LB BrothCarl RothX968.2
LysozymeSigma-AldrichL6876
MethanolCarl Roth82.2
MgCl2Carl RothKK36.3
Mg-glutamateSigma-Aldrich49605
Micro Bio-Spin Chromatography ColumnsBio-Rad732-6204
NADSigma-AldrichN6522
NHS-azide linker (y-azidobutyric acid oxysuccinimide ester)BaseclickBCL-033-5
PEG-8000Carl Roth263.2
pH stripesCarl Roth549.2
Phenylmethylsulfonyl fluorideCarl Roth6367.2
Phosphate-buffered salineVWR76180-684
Phosphoric acidSigma-AldrichW290017
PolyethyleneimineSigma-Aldrich408727
Potassium phosphate dibasic solutionSigma-AldrichP8584
Potassium phosphate monobasic solutionSigma-AldrichP8709
Qiagen Miniprep KitQiagen27106
RNAPol reaction bufferNEBB9012
RNase inhibitor murineNEBM0314S
RNaseZap WipesThermoFisherAM9788
rNTPNEBN0466S
Roti-Phenol/Chloroform/Isoamyl alcoholCarlrothA156.1
RTS Amino Acid Sampler5 Prime2401530
Slide-A-Lyzer Dialysis Cassettes, 10k MWCO (Kit)Thermo-Scientific66382
Sodium chlorideCarl Roth9265.1
Sodium hydroxideCarl Roth8655.1
SpermidineSigma-Aldrich85558
Sterile-filtered (0.22 µm filter)Carl RothXH76.1
T7 polymeraseNEBM0251S
TBTA (tris(benzyltriazolylmethyl)amine)Sigma-Aldrich678937
TCEP (tris(2-carboxyethyl)-phosphine hydrochloride)Sigma-AldrichC4706
Tris baseFischerBP1521
tRNA (from E. coli)Roche Applied ScienceMRE600
UTPUSB23160

References

  1. Chen, I. A., Szostak, J. W. A kinetic study of the growth of fatty acid vesicles. Biophysical Journal. 87 (2), 988-998 (2004).
  2. Nourian, Z., Roelofsen, W., Danelon, C. Triggered gene expression in fed-vesicle microreactors with a multifunctional membrane. Angewandte Chemie International Edition. 51 (13), 3114-3118 (2012).
  3. Hardy, M. D., et al. Self-reproducing catalyst drives repeated phospholipid synthesis and membrane growth. Proceedings of the National Academy of Sciences of the United States of America. 112 (27), 8187-8192 (2015).
  4. Scott, A., et al. Cell-Free Phospholipid Biosynthesis by Gene-Encoded Enzymes Reconstituted in Liposomes. PLoS ONE. 11 (10), e0163058(2016).
  5. Deamer, D. W., Barchfeld, G. L. Encapsulation of macromolecules by lipid vesicles under simulated prebiotic conditions. Journal of Molecular Evolution. 18 (3), 203-206 (1982).
  6. Adamala, K., Szostak, J. W. Nonenzymatic Template-Directed RNA Synthesis Inside Model Protocells. Science. 342 (6162), 1098-1100 (2013).
  7. Zhu, T. F., Szostak, J. W. Coupled growth and division of model protocell membranes. Journal of the American Chemical Society. 131 (15), 5705-5713 (2009).
  8. Kurihara, K., et al. Self-reproduction of supramolecular giant vesicles combined with the amplification of encapsulated DNA. Nature Chemistry. 3 (10), 775-781 (2011).
  9. Chu, H. -S., et al. Expression analysis of an elastin-like polypeptide (ELP) in a cell-free protein synthesis system. Enzyme and Microbial Technology. 46 (2), 87-91 (2010).
  10. Martino, C., et al. Protein Expression, Aggregation, and Triggered Release from Polymersomes as Artificial Cell-like Structures. Angewandte Chemie International Edition. 51 (26), 6416-6420 (2012).
  11. Vogele, K., et al. Towards synthetic cells using peptide-based reaction compartments. Nature Communications. 9 (1), 3862(2018).
  12. Huber, M. C., et al. Designer amphiphilic proteins as building blocks for the intracellular formation of organelle-like compartments. Nature Materials. 14 (1), 125-132 (2014).
  13. McPherson, D. T., Xu, J., Urry, D. W. Product purification by reversible phase transition following Escherichia coli expression of genes encoding up to 251 repeats of the elastomeric pentapeptide GVGVP. Protein Expression and Purification. 7 (1), 51-57 (1996).
  14. Urry, D. W. Physical chemistry of biological free energy transduction as demonstrated by elastic protein-based polymers. The Journal of Physical Chemistry B. 101 (51), 11007-11028 (1997).
  15. Urry, D. W., et al. Elastin: a representative ideal protein elastomer. Philosophical Transactions of the Royal Society B: Biological Sciences. 357 (1418), 169-184 (2002).
  16. Meyer, D. E., Chilkoti, A. Purification of recombinant proteins by fusion with thermally-responsive polypeptides. Nature Biotechnology. 17 (11), 1112-1115 (1999).
  17. Meyer, D. E., Chilkoti, A. Genetically encoded synthesis of protein-based polymers with precisely specified molecular weight and sequence by recursive directional ligation: examples from the elastin-like polypeptide system. Biomacromolecules. 3 (2), 357-367 (2002).
  18. Sun, Z. Z., et al. Protocols for implementing an Escherichia coli based TX-TL cell-free expression system for synthetic biology. Journal of Visualized Experiments. (79), e50762(2013).
  19. Caschera, F., Noireaux, V. Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription-translation system. Biochimie. 99, 162-168 (2014).
  20. Schwarz-Schilling, M., Aufinger, L., Mückl, A., Simmel, F. C. Chemical communication between bacteria and cell-free gene expression systems within linear chains of emulsion droplets. Integrative Biology. 8 (4), 564-570 (2016).
  21. Garamella, J., Marshall, R., Rustad, M., Noireaux, V. The All E. coli TX-TL Toolbox 2.0: A Platform for Cell-Free Synthetic Biology. ACS Synthetic Biology. 5 (4), 344-355 (2016).
  22. Rideau, E., Dimova, R., Schwille, P., Wurm, F. R., Landfester, K. Liposomes and polymersomes: a comparative review towards cell mimicking. Chemical Society Reviews. 47 (23), 8572-8610 (2018).
  23. Filonov, G. S., Moon, J. D., Svensen, N., Broccoli Jaffrey, S. R. Broccoli: Rapid Selection of an RNA Mimic of Green Fluorescent Protein by Fluorescence-Based Selection and Directed Evolution. Journal of the American Chemical Society. 136 (46), 16299-16308 (2014).
  24. Zhang, S., Cahalan, M. D. Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit. Journal of Visualized Experiments. (6), 247(2007).
  25. Stetefeld, J., McKenna, S. A., Patel, T. R. Dynamic light scattering: a practical guide and applications in biomedical sciences. Biophysical Reviews. 8 (4), 409-427 (2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Peptide VesiclesELP ExpressionVesicle FormationDehydration RehydrationGlass Beads MethodDynamic Light ScatteringFluorescence Plate ReaderFRET AssayRNA Transcription