A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Bacterial Peptide Display for the Selection of Novel Biotinylating Enzymes

5.4K views

DOI:

10.3791/60266

October 3rd, 2019

In This Article

Summary

Here we present a method to select for novel variants of the E. coli biotin-protein ligase BirA that biotinylates a specific target peptide. The protocol describes the construction of a plasmid for the bacterial display of the target peptide, generation of a BirA library, selection and characterization of BirA variants.

Abstract

Biotin is an attractive post-translational modification of proteins that provides a powerful tag for the isolation and detection of protein. Enzymatic biotinylation by the E. coli biotin-protein ligase BirA is highly specific and allows for the biotinylation of target proteins in their native environment; however, the current usage of BirA mediated biotinylation requires the presence of a synthetic acceptor peptide (AP) in the target protein. Therefore, its application is limited to proteins that have been engineered to contain the AP. The purpose of the present protocol is to use the bacterial display of a peptide derived from an unmodified target protein to select for BirA variants that biotinylates the peptide. The system is based on a single plasmid that allows for the co-expression of BirA variants along with a scaffold for the peptide display on the bacterial surface. The protocol describes a detailed procedure for the incorporation of the target peptide into the display scaffold, creation of the BirA library, selection of active BirA variants and initial characterization of the isolated BirA variants. The method provides a highly effective selection system for the isolation of novel BirA variants that can be used for the further directed evolution of biotin-protein ligases that biotinylate a native protein in complex solutions.

Introduction

Biotinylation of a protein creates a powerful tag for its affinity isolation and detection. Enzymatic protein biotinylation is a highly specific post-translational modification catalyzed by biotin-protein ligases. The E. coli biotin-protein ligase BirA is extremely specific and covalently biotinylates only a restricted number of naturally occurring proteins at specific lysine residues1. The advantages of the BirA catalyzed biotinylation are currently harnessed by fusing the target protein with a small synthetic 15-amino-acid biotin acceptor peptide (AP) that is effectively biotinylated2 and allows for the highly specific and efficient in vivo and in vitro biotinylation by co-expression or addition of BirA3,4,5. Although the in vivo and in vitro BirA catalyzed biotin-protein ligation is an attractive labeling strategy, its application is limited to samples that contain AP-fused proteins. The purpose of this method is the development of new mutants of biotin-protein ligases that selectively biotinylate native unmodified proteins and, thereby expand the number of applications in which the enzymatic biotinylation strategy can be used.

Protein function can be evolved through iterative rounds of the gene mutation, selection, and amplification of gene variants with the desired function. A strong and efficient selection strategy is crucial for the directed evolution and biotin-protein ligase activity is readily selected due to the strong binding between biotin and streptavidin and its homologs6. Phage display technologies allow for the selection of phages that display biotinylated peptides7,8. Since amplification of isolated phages requires infection of a bacterial host, however, the phage selection with streptavidin creates a bottleneck in that the high-affinity binding of biotin to streptavidin is virtually irreversible under non-denaturing conditions. To ensure reversible binding of biotinylated phages, monomeric avidins with lower affinity were used which resulted in a modest ~10-fold enrichment7. We recently developed a bacterial display method for the isolation of novel BirA variants that eliminates the need for the elution from the affinity matrix and thereby removes a bottleneck from previous BirA selection systems9. Indeed, our bacterial display system allows for a >1,000,000-fold enrichment of active clones in a single selection step9, thus providing an effective selection system for the directed evolution of novel BirA variants.

Our bacterial display system consists of two components, BirA with a C-terminal 6xHis tag and a scaffold protein that allows for the surface display of a target peptide. We used the scaffold protein enhanced circularly permuted outer membrane protein X (eCPX) since the effective display of peptides can be observed at both the N- and C-termini10,11. The fusion of the target peptide sequence to the C-terminus of eCPX ensures biotinylation of bacteria expressing active BirA variants. The bacteria allow for the effective streptavidin selection as the biotinylated peptide now displays on the surface (Figure 1a).

The purpose of this method is to select for novel variants of BirA that biotinylates peptide sequences present in native proteins. The system is encoded by genes present on the plasmid pBAD-BirA-eCPX-AP, which contains an arabinose-inducible promoter controlling BirA (araBAD), and a T7 promoter controlling eCPX9 (Figure 1b). The present protocol describes the detailed procedure for 1) incorporation of a peptide derived from a target protein into the C-terminal of eCPX, 2) creation of a mutational library of BirA by error-prone PCR, 3) selection of streptavidin-binding bacteria by magnetic-activated cell sorting (MACS), 4) quantification of bacteria enrichment, and 5) initial characterization of isolated clones.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Insertion of Peptide Coding Sequencing Sequence in pBAD BirA-eCPX-AP

NOTE: To select for BirA variants that biotinylate a native target protein, start by identifying a 15-amino acid peptide sequence in the proteins primary sequence that contains at least one lysine (K) residue.

  1. Go to the sequence manipulation suite12.
  2. Paste the identified 15 amino acid peptide sequence into the input box in FASTA format and press Submit.
  3. Select and copy the 45 nucleotide reverse translation of the peptide sequence.
  4. Download the GenBank File for pBAD-BirA-eCPX-AP from http://n2t.net/addgene:121907.
  5. Load the file in a plasmid editor (e.g., ApE) and, in the feature window, select the AP sequence designated "AviTag(TM)".
  6. Right-click the highlighted AP sequence in the DNA sequence window and select Paste Rev-Com in the contextual menu.
    NOTE: The coding sequence of eCPX is in the reverse direction and the peptide coding sequence should, therefore, be pasted as a reverse complement.
  7. Right-click the highlighted sequence and select New Feature.
  8. Add a descriptive name of the inserted sequence and press OK.
  9. Select Save As in the File menu to save the modified file.
  10. Design the forward primer to include the last 30 nucleotides of the reverse complement of the peptide coding sequence and add the plasmid binding nucleotide sequence (3’-GCGGCCGCCTGC-5’) to its 5’ end.
  11. Design the reverse primer to include the first 30 nucleotides of the reverse complement of the peptide coding sequence and add the plasmid binding nucleotide sequence (3’- CTTAAGTAATGTTTAAACGAATTCGAG-5’) to its 5’ end.
  12. Set up a 20 µL PCR reaction in a thin-walled PCR tube by adding the reagents listed in Table 1.
  13. Transfer the tube to a thermal cycler and perform PCR using a program with an initial denaturing at 98 °C for 30 s, 30 cycles of [15 s at 98 °C, 15 s at 60 °C and 3 min at 72 °C], final extension for 2 min at 72 °C and hold at 4 °C.
  14. Run 5 µL of the PCR reaction on a 1% agarose gel to confirm the amplification of a ~6 kb PCR product.
    NOTE: If no PCR product is observed, optimize the PCR condition according to the manufacturer’s instructions. The protocol can be paused here.
  15. Add 1 µL of DpnI to the PCR reaction and incubate for 1 h at 37 °C
  16. Transform the competent E. coli with 2 µL of DpnI digested PCR reaction and plate on Lysogenic broth (LB)/Amp plates. Incubate overnight at 37 °C.
  17. Inoculate 5 mL LB containing 100 µg/mL ampicillin with a single colony. Incubate overnight at 37 °C with shaking at 200 rpm.
    NOTE: It is recommended to test at least 6 colonies.
  18. Make freeze stocks of 850 µL of each overnight culture by adding glycerol to a final concentration of 15% to the culture. Store at -80 °C.
  19. Extract the plasmid DNA from the remaining 4 mL culture by mini-prep DNA extraction kit.
  20. Confirm the correct insert of the peptide coding sequence by DNA sequencing using T7 Terminal primer (GCTAGTTATTGCTCAGCGG).

2. Generation of a BirA Library

NOTE: The initial BirA mutational library (Figure 1c, step 1) is created by error-prone PCR. Other methods to generate the BirA mutational library are likely to work as well.

  1. Synthesize the mutant megaprimers with BirA-6xHis forward (ATGAAGGATAACACCGTGCC) and reverse (TCAATGATGATGATGATGATGTTT) primers using 1 ng of pBAD-BirA-eCPX with the target peptide sequence (prepared and confirmed in step 1.20) as a template and 35 PCR cycles with an annealing temperature of 60 °C according to the manufacturer’s instruction.
  2. Run 5 µL of the amplification reaction on a 1% agarose gel to verify the amplification of a 984 bp PCR product.
  3. Purify the PCR product from the remaining 45 µL of the amplification reaction using a commercial PCR purification kit and use a spectrophotometer to quantitate the DNA yield.
    NOTE: Purification from a single 45 µL amplification reaction generally produces a enough yield (>250 ng).
  4. Prepare the sample reaction in a thin-walled PCR tube by adding the reagents listed in Table 2.
  5. Transfer the reaction mixture to a thermal cycler and run the PCR with the mutant megaprimers prepared in step 2.3 using the following parameters: 1 min at 95 °C and 25 cycles of 50 s at 95 °C, 50 s at 60 °C and 12 min at 68 °C. Store the reaction at 4 °C.
  6. Add 1 µL of DpnI restriction enzyme directly to the amplification reaction and mix gently.
  7. Spin down the reaction mixture and incubate for 2 h at 37 °C.
  8. Transform T7 Express lysY/Iq competent E. coli cells with 2 µL of the DpnI reaction.
  9. Inoculate 100 mL LB containing 100 µg/mL ampicillin with the transformed cells and incubate overnight at 37 °C with shaking at 200 rpm.
  10. Make freezer stocks with 10 mL of the overnight culture in LB with 15% glycerol and store at -80 °C.

3. Selection of Bacteria Expressing Biotinylated Peptide

NOTE: This part of the protocol covers step 2-5 of Figure 1c. It is highly recommended that the selection approach is setup using pBAD-BirA-eCPX-AP and pBAD-BirA-eCPX-AP(K10A) as positive and negative controls.

  1. Inoculate 100 mL of LB containing 1% glucose and 100 µg/mL ampicillin with 1 mL of BirA library and incubate overnight at 37 °C with shaking at 200 rpm.
  2. Inoculate 5 mL of LB containing 1% glucose and 100 µg/mL ampicillin with 100 µL of the overnight culture.
  3. Incubate for 2 h and 30 min until the culture reaches an OD600 of approximately 0.5.
  4. Induce eCPX and BirA expression with 0.2% w/v L-arabinose, 100 µM Isopropyl β-D-1-thiogalactopyranoside (IPTG) and 100 µM biotin and shake the culture at 200 rpm for 1 h at 37 °C.
  5. Centrifuge the culture for 10 min at 5,000 x g and remove the supernatant.
  6. Resuspend the cells in 1 mL of the ice-cold PBS and centrifuge at 5,000 x g for 5 min.
  7. Discard the supernatant and resuspend the cells in 400 µL of ice-cold PBS and store cells on the ice.
  8. Remove 10 µL of resuspended cells and store on the ice in a 1.5 mL tube labeled "Input".
  9. Wash 20 µL of streptavidin magnetic beads in 1 mL of ice-cold PBS and place the tube in a bench top magnetic particle separator before carefully removing the supernatant.
  10. Resuspend the streptavidin magnetic beads in 20 µL of ice-cold PBS and transfer to the 390 µL of resuspended cells from step 3.8.
  11. Mix by gently pipetting and then incubate for 30 min at 4 °C.
    NOTE: Do not vortex as this may lyse the cells. Aggregation of beads is often observed with a high abundance of bacteria displaying a biotinylated peptide.
  12. Place a column with ferromagnetic spheres in a magnetic particle separator and wash with 5 mL of ice-cold PBS.
  13. Transfer cells and streptavidin magnetic beads to the column attached in the separator.
  14. Once the column reservoir is empty, add 500 µL of ice-cold PBS and repeat until the column has been washed with a total volume of 5 mL of ice-cold PBS.
  15. Remove the column from the separator and place it in a 1.5 mL tube.
  16. Pipette 1 mL of the ice-cold PBS onto the column and elute the magnetically labeled cells by applying the plunger supplied with the column.
  17. Transfer the 1.5 mL tube to a bench top separator and wash the magnetically labeled cell with 1 mL of ice-cold PBS.
  18. Gently resuspend the magnetically labeled cells in 1 mL of the ice-cold PBS before removing and storing 10 µL of the resuspension in a 1.5 mL tube labeled "Output".
  19. Inoculate 100 mL of LB containing 1% glucose and 100 µg/mL ampicillin with the magnetically labeled cells and incubate overnight at 37 °C with shaking at 200 rpm.
  20. The next day, use 10 mL of the overnight culture to make freezer stocks with cells in LB with 15% glycerol and store at -80 °C and 1 mL of the overnight culture for the next round of selection, i.e., step 3.2.
    NOTE: Generally, 3-5 rounds of selection are recommended for the enrichment of streptavidin binding bacteria.

4. Quantification of Enrichment

NOTE: Quantification of the live bacteria in the "input" and "output" samples are performed after each selection round by plating of serial dilutions of the samples and subsequent counting of colony forming units (CFUs).

  1. Add 990 µL ice-cold PBS to the input (from step 3.8) and output (from step 3.18) samples and label the tubes "Input 10-2" and "Output 10-2", respectively.
  2. Make 10-fold serial dilutions of the "Input 10-2" and "Output 10-2" samples in ice-cold PBS until a final dilution of 10-10 is reached in the input sample and 10-4 in the output sample.
  3. Plate 100 µL of samples from "Input 10-6", "Input 10-8", "Input 10-10", "Output 10-2", "Output 10-3" and "Output 10-4" on LB/Amp plates and incubate overnight at 37 °C.
  4. Count the number of colonies on the plates with clearly separated colonies. Multiply the colony count with the dilution factor to obtain the bacterial concentration count/100 µL.
  5. Calculate the total bacterial count in the input and output samples by multiplying the cell concentration with the input (400 µL) and output volume (1 mL), respectively, and estimate the enrichment by dividing output with input cell count.
    NOTE: A significant enrichment should be visible after 3-5 selection rounds

5. Characterization of Selected BirA Variant

NOTE: The characterization can be performed after selecting BirA variants from the first BirA library; however, the BirA variants generally have low activity towards the peptide. Therefore, an additional round of mutation and selection can also be performed before the characterization. Usually, 10 clones from the final selection round are isolated for further characterization.

  1. Inoculate 5 mL LB containing 100 µg/mL ampicillin with selected clones from the final selection round. In addition, inoculate 5 mL LB containing 100 µg/mL ampicillin with T7 Express lysY/Iq E. coli transformed with pBAD-BirA-eCPX-AP, which will be used as a positive control for the western blot described below.
  2. Incubate overnight at 37 °C with shaking at 200 rpm.
  3. Make freeze stocks of 850 µL of each overnight culture by adding glycerol to a final concentration of 15% to the culture. Store at -80 °C.
  4. Inoculate 5 mL of LB containing 100 µg/mL ampicillin with 100 µL of overnight culture and incubate at 37 °C with shaking at 200 rpm for 2 h.
  5. Extract the plasmid DNA from the remaining 4 mL culture by s commercially mini-prep DNA extraction kit. Perform the DNA sequence in forward and reverse directions of the BirA variants with pBAD (ATGCCATAGCATTTTTATCC) and pTrcHis rev (CTTCTGCGTTCTGATTTAATCTG) primers.
  6. Add 0.2% w/v L-arabinose and 100 µM IPTG and 100 µM biotin to cultures from step 5.4 and shake the culture at 200 rpm for 1 h at 37 °C to induce the expression of eCPX and BirA variants.
  7. Transfer 65 µL of the culture to 1.5 mL tubes containing 25 µL of the sample loading buffer and 10 µL of the reducing agent.
  8. Incubate at 95 °C for 5 min.
  9. Load the sample (including the positive control) onto a 12% SDS-polyacrylamide gel along with a size marker and perform gel electrophoresis at 200 V for approximately 45 min until the 20, 25 and 37 kDa standard bands are clearly separated.
  10. Release the gel from the cassette and assemble the sandwich for blotting of the gel onto a PVDF membrane.
  11. Electroblot at 35 V for 2 h on ice.
  12. Remove the PVDF membrane and incubate in blocking buffer [PBS, 0.05% Tween-20, 3% Skim Milk Powder] for 1 h at room temperature with shaking.
  13. Prepare the biotin-detection solution by diluting streptavidin-HRP 1:1,000 in PBST.
    NOTE: The blocking buffer contains biotin and should therefore not be used as dilution buffer for streptavidin-HRP.
  14. Discard the blocking buffer, wash the membrane swiftly in PBST [PBS, 0.05% Tween-20] and add the biotin-detection solution. Incubate for 1 h at room temperature with shaking.
  15. Discard the biotin-detection solution and wash the membrane thoroughly in PBST for 5 min twice and 10 min once with gentle shaking at room temperature.
  16. Discard the PBST, add 2 mL ECL mix and incubate for 1 min with shaking.
  17. Dry the membrane swiftly on a tissue paper and develop the image on an X-ray film or in a digital gel imaging system.
    NOTE: In the lane loaded with the positive control, two distinct streptavidin-reaction bands should be clearly visible: a 30 kDa biotinylated endogenously expressed protein and the ~22 kDa eCXP-AP band. If the 10 selected colonies can biotinylate the displayed peptide, a band at ~22 kDa should be visible. The intensity of these bands is generally lower than the positive control and may, therefore, require longer exposure times. 

Access restricted. Please log in or start a trial to view this content.

Results

Western blot of pBAD-BirA-eCPX-AP expressing bacteria produces a ~22 kDa streptavidin-reacting band consistent with the molecular weight of eCPX (Figure 2a). Unlike BirA-6xHis, biotinylated eCPX-AP was present in both uninduced and induced cultures (Figure 2a) due to a small degree of T7 promoter activity even in uninduced cultures and subsequent biotinylation of the AP by endogenous BirA. In BirA-eCPX-AP(K10A) expressing cultur...

Access restricted. Please log in or start a trial to view this content.

Discussion

As for all selection methods, the stringency of the washing steps is of utmost importance. Since bacteria do not need to be eluted from the beads before the amplification of the selected clones, the high affinity binding between biotin and streptavidin can be used instead of using lower affinity avidins, as previously done with the phage display system, for the selection of BirA variants7,8. This ensures that rare clones are selected and that non-biotinylated bac...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors thank Mohamed Abdullahi Ahmed for the expert technician assistance. This work was supported by grants from the Lundbeck Foundation, the Novo Nordisk Foundation, the Danish Kidney Association, the Aase og Ejnar Danielsen Foundation, the A.P. Møller Foundation for the Advancement of Medical Science, and Knud and Edith Eriksen Memorial Foundation.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
10% precast polyacrylamide gelBio-Rad4561033
AmpicilinSigma-AldrichA1593
ApE - A plasmid editor v2.0NANAdownloaded from http://jorgensen.biology.utah.edu/wayned/ape/
ArabinoseSigma-AldrichA3256
BiotinSigma-AldrichB4501
DMSOSigma-AldrichD2650
DPBS (10x), no calcium, no magnesiumThermoFischer Scientific14200083
DpnI restriction enzymeNew England BioLabsR0176
Dynabeads MyOne Streptavidin C1ThermoFischer Scientific65001
GenElute Plasmid Miniprep KitSigma-AldrichPLN350
GeneMorph II EZClone Domain Mutagensis kitAgilent Technologies200552
GlucoseSigma-AldrichG8270
GlycerolSigma-AldrichG5516
Immobilon-P PVDF MembraneMilliporeIPVH15150
IPTGSigma-AldrichI6758
LS ColumnsMiltenyi Biotec130-042-401
NaClSigma-AldrichS7653
NEB 5-alpha Competent E. coliNew England BioLabsC2987
NuPAGE LDS Sample Buffer (4x)ThermoFischer ScientificNP0007
NuPAGE Sample Reducing Agent (10x)ThermoFischer ScientificNP0009
pBAD-BirA-eCPX-APAddgene121907Used a template and positive control
pBAD-BirA-eCPX-AP(K10A)Addgene121908negative control
Q5 High-Fidelity DNA PolymeraseNew England BioLabsM0491For insertion of peptide sequence in pBAD-BirA-eCPX-AP, any high fidelity polymerase will do
QuadroMACS SeparatorMiltenyi Biotec130-090-976
Skim Milk PowderSigma-Aldrich70166
Streptavidin-HRPAgilent TechnologiesP0397
T7 Express lysY/Iq Competent E. coliNew England BioLabsC3013
TryptoneMilliporeT9410
Tween-20Sigma-AldrichP9416
Western Lightning Plus-ECLPerkinElmerNEL103001EA
Yeast extractSigma-AldrichY1625

References

  1. Polyak, S. W., Abell, A. D., Wilce, M. C. J., Zhang, L., Booker, G. W. Structure, function and selective inhibition of bacterial acetyl-CoA carboxylase. Applied Microbiology and Biotechnology. 93 (3), 983-992 (2011).
  2. Schatz, P. J. Use of Peptide Libraries to Map the Substrate Specificity of a Peptide-Modifying Enzyme: A 13 Residue Consensus Peptide Specifies Biotinylation in Escherichia coli. Nature Biotechnology. 11 (10), 1138-1143 (1993).
  3. de Boer, E., Rodriguez, P., et al. Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences. 100 (13), 7480-7485 (2003).
  4. Tannous, B. A., Grimm, J., Perry, K. F., Chen, J. W., Weissleder, R., Breakefield, X. O. Metabolic biotinylation of cell surface receptors for in vivo imaging. Nature Methods. 3 (5), 391-396 (2006).
  5. Howarth, M., Takao, K., Hayashi, Y., Ting, A. Y. Targeting quantum dots to surface proteins in living cells with biotin ligase. Proceedings of the National Academy of Sciences. 102 (21), 7583-7588 (2005).
  6. Michael Green, N. Avidin and streptavidin. Avidin-Biotin Technology. 184, 51-67 (1990).
  7. Fujita, S., Taki, T., Taira, K. Selection of an Active Enzyme by Phage Display on the Basis of the Enzyme's Catalytic Activity in vivo. ChemBioChem. 6 (2), 315-321 (2005).
  8. Iwamoto, M., Taki, T., Fujita, S. Selection of a biotin protein ligase by phage display using a combination of in vitro selection and in vivo enzymatic activity. Journal of Bioscience and Bioengineering. 107 (3), 230-234 (2009).
  9. Granhøj, J., Dimke, H., Svenningsen, P. A bacterial display system for effective selection of protein-biotin ligase BirA variants with novel peptide specificity. Scientific Reports. 9 (1), 4118(2019).
  10. Rice, J. J. Bacterial display using circularly permuted outer membrane protein OmpX yields high affinity peptide ligands. Protein Science. 15 (4), 825-836 (2006).
  11. Rice, J. J., Daugherty, P. S. Directed evolution of a biterminal bacterial display scaffold enhances the display of diverse peptides. Protein Engineering Design and Selection. 21 (7), 435-442 (2008).
  12. Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques. 28, 1102-1104 (2000).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

BirA VariantsBiotinylation SelectionStreptavidin SelectionPlasmid LibraryPCR AmplificationWestern Blot AnalysisStreptavidin Magnetic BeadsColony CountingFreezer Stocks