Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

Summary

Here methods are presented to understand anti-cancer effects of Lactobacillus cell-free supernatant (LCFS). Colorectal cancer cell lines show cell deaths when treated with LCFS in 3D cultures. The process of generating spheroids can be optimized depending on the scaffold and the analysis methods presented are useful for evaluating the involved signaling pathways.

Abstract

This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using supernatants from Lactobacillus fermentum cell culture, considered as probiotics cultures. The use of 3D cultures to test Lactobacillus cell-free supernatant (LCFS) are a better option than testing in 2D monolayers, especially as L. fermentum can produce anti-cancer effects within the gut. L. fermentum supernatant was identified to possess increased anti-proliferative effects against several colorectal cancer (CRC) cells in 3D culture conditions. Interestingly, these effects were strongly related to the culture model, demonstrating the notable ability of L. fermentum to induce cancer cell death. Stable spheroids were generated from diverse CRCs (colorectal cancer cells) using the protocol presented below. This protocol of generating 3D spheroid is time saving and cost effective. This system was developed to easily investigate the anti-cancer effects of LCFS in multiple types of CRC spheroids. As expected, CRC spheroids treated with LCFS strongly induced cell death during the experiment and expressed specific apoptosis molecular markers as analyzed by qRT-PCR, western blotting, and FACS analysis. Therefore, this method is valuable for exploring cell viability and evaluating the efficacy of anti-cancer drugs.

Introduction

Probiotics are the most advantageous microorganisms in the gut that improves immune homeostasis and host energy metabolism¹. Probiotics from Lactobacillus and Bifidobacterium are the most advanced of its kind found in the intestine^2,3. Previous investigations have shown that Lactobacillus has inhibitory and antiproliferative effects on several cancers, including colorectal cancer⁴. Moreover, probiotics prevent inflammatory bowel diseases, Crohn’s disease, and ulcerative colitis^5,6. However, most studies with probiotics were performed in two dimensional (2D) monolayers that are grown on solid surfaces.

Artificial culture systems lack environmental features, which is not natural for cancer cells. To overcome this limitation, three dimensional (3D) culture systems have been developed^7,8. Cancer cells in 3D show improvements in terms of basic biological mechanisms, such as cell viability, proliferation, morphology, cell-cell communication, drug sensitivity, and in vivo relevance^9,10. Moreover, spheroids are made from multicellular types of colorectal cancer and are dependent on cell-cell interactions and the extracellular matrix (ECM)¹¹. Our previous study has reported that probiotic cell-free supernatant (CFS) produced using Lactobacillus fermentum showed anti-cancer effects on 3D cultures of colorectal cancer (CRC) cells¹². We proposed that CFS is a suitable alternative strategy for testing probiotic effects on 3D spheroids¹².

Here, we present an approach that can accommodate multicellular types of 3D colorectal cancer for the analysis of therapeutic effects of probiotic cell-free supernatant (CFS) on several 3D colorectal cancer mimicry systems. This method provides a means for the analysis of related probiotic and anti-cancer effects in vitro.

Protocol

1. Bacterial cell cultures and preparation of Lactobacillus  cell-free supernatant (LCFS)

NOTE: Steps 1.2 – 1.9 are conducted in an anaerobic chamber.

1. Prepare an MRS agar plate and broth containing L-cysteine and sterilize by autoclaving.
2. Pre-incubate the MRS agar plate in H₂ anaerobic chamber maintained at 37 ˚C with 20 ppm oxygen.
3. Thaw Lactobacillus bacterial stock and inoculate the agar plate with the bacterial culture (Figure 1A (i)).
4. Incubate bacteria for 2 - 3 days in H₂ anaerobic chamber at 37 ˚C and 20 ppm oxygen until single bacterial colonies are obtained.
5. Wash and dry the Hungate type anerobic culture tube. Autoclave the culture tube at 121 ˚C for 15 min.
6. Then incubate the tube in H₂ anaerobic chamber at 37 ˚C and 20 ppm oxygen to remove oxygen.
7. Place 2 - 3 mL of MRS broth into the tube. Seal the tube with a butyl rubber stopper and screw the cap.
8. Obtain a single colony with a loop and place it into the 1.5 mL culture tube with 500 µL of 1x PBS. (Figure 1A (ii)).
9. Suspend the colony using a 1 mL syringe (Figure 1A (iii)). Do this by, inserting the needle of the 1 mL syringe in the center of the tube lid, aspirating the suspended colony and then resuspending it back into the MRS broth media. (Figure 1A (iv)).
10. Incubate the MRS broth media in a shaker incubator for 2 days (37 °C, 5% CO₂, 200 rpm).
11. Measure the optical density (OD) using a spectrophotometer to monitor bacterial growth curves until the absorbance at OD₆₂₀ reaches to 2.0.
12. Separate the bacterial pellets and the conditioned media by centrifuging at 1,000 x g for 15 min. Wash the collected bacterial pellets with 1x PBS and resuspend in 4 mL of RPMI 1640 supplemented with 10% fetal bovine serum. Do not include any antibiotics in the medium.
13. Maintain the bacterial pellets in RPMI and incubate in a shaker incubator for 4 h at 37 °C with 5% CO₂ at a speed of 100 rpm.
14. For the preparation of the probiotic supernatant, remove the bacterial pellet via centrifugation at 1000 x g, for 15 min at 4 °C. Sterile-filter the recovered supernatant using a 0.22 μm filter and store at −80 °C until use.

2. Generation of spheroids

1. Preparing colorectal cancer cell lines
   1. Grow DLD-1, HT-29, and WiDr cell lines as monolayers until 70-80% confluency and incubate the plate at 37 °C in a 5% CO₂ incubator (Growth medium: RPMI containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin).
   2. For cells grown in 100 mm Petri dish, wash the plate twice with 4 mL of 1x PBS. Add 1 mL of 0.25% trypsin-EDTA and incubate the Petri dish for 2 min at 37 °C in a 5% CO₂ incubator to dissociate the cells.
   3. After incubation, check for the cell dissociation under a microscope and neutralize trypsin-EDTA with 5 mL of growth medium.
   4. Transfer the dissociated cells to a 15 mL conical tube and centrifuge for 3 min at 300 x g.
   5. Discard the supernatant and resuspend gently with 3 mL of growth media.
   6. Count the cells with trypan blue to determine viable cells using a hemocytometer. (Figure 1B (i))
2. Spheroid formation
   1. In a 15 mL conical tube, dilute the cells from 2.1.5 to obtain 1 - 2 x 10⁵ cells/mL (Figure 1B (ii))
   2. Add final concentration of 0.6% methylcellulose to the cell suspension and transfer the diluted cells to a sterile reservoir.
      NOTE: For each cell line, the amount of methylcellulose needed should be titrated and determined accordingly.
   3. Use a multichannel pipette to dispense 200 µL of cells to each well of an ultra-low attachment 96-well round bottom microplate. (Figure 1B (iii))
   4. Incubate the plate at 37 °C in a 5% CO₂ incubator for 24 - 36 h.
   5. After 24 - 36 h, observe the plate under a light microscope to ensure spheroid formation.

3. Treating 3D colorectal cancer cells with LCFS

1. Generate spheroids as described in steps 2 and 3.
2. Before performing the LCFS treatment, thaw the frozen LCFS at room temperature (RT) for 10 - 20 min.
3. Inoculate the LCFS stock solution into a growth medium. Serially dilute to 25%, 12.5%, and 6% in the growth medium (i.e., 25% LCFS = 150 µL of growth medium + 50 µL of LCFS).
4. Take out the cell culture plate containing spheroids from the incubator and remove as much of the growth medium as possible from each well using a 200 μL pipette.
5. Add the growth media with LCFS on the cells and incubate at 37 °C in a 5% CO₂ incubator for 24 - 48 h.
   NOTE: The volume to be used will depend on the plate size as follows: 2 mL for 6-well cell culture plates; 200 μL for 96-well cell culture plates.

4. Cell viability for spheroids

1. Prepare 8 - 10 LCFS-treated colorectal cancer spheroids in opaque-walled multi-well plates (cell viability assays are performed 48 h after LCFS treatment).
2. Thaw the cell viability reagent (see Table of Materials) at 4 °C for overnight.
3. Equilibrate the cell viability reagent to room temperature before use.
4. Before performing the assay, remove 50% of the growth media from the spheroids.
5. Add 100 µL of cell viability reagent to each well.
   NOTE: The volume to be used will depend on the plate size as follows: 100 μL for 96-well cell culture plates.
6. Mix the reagent vigorously for 5 min to promote cell lysis.
7. Incubate for 30 min – 2 h at 37 °C.
8. Record the luminescence.

5. Quantitative real-time polymerase chain reaction analysis for spheroids

1. For each condition, prepare 10 - 15 spheroids in a 2 mL tube and centrifuge for 3 min at 400 x g.
2. Discard the supernatant and wash the spheroids twice in 1 mL of ice-cold 1x PBS.
   NOTE: Avoid centrifugation, let the spheroids settle down.
3. Aspirate as much of the 1x PBS as possible and isolate RNA using a commercially available kit.
4. Synthesize cDNA from 1 μg of RNA using a commercially available kit as per the manufacturer’s protocol.
5. Prepare a master mix to run all samples in triplicate (see Table 1 and Table 2).
6. Perform the amplification in a 20 µL of the template master mix into each qPCR plate well.
7. Mix reactions well and spin if necessary.
8. Run samples as per the recommendations of the instrument manufacturer (Table 3).

6. Western blotting from spheroids

NOTE: When collecting spheroids, use a 200 μL pipette and cut the end of the tips to avoid disturbing their structure.

1. For each condition, prepare 30 - 40 spheroids in a 2 mL tube.
2. Place the tube on ice and let the spheroids settle down to the bottom of the 2 mL tube.
3. Discard the supernatant and wash the spheroids twice in 1 mL ice-cold 1x PBS
   NOTE: Avoid centrifugation, let the spheroids settle down.
4. Aspirate as much of the 1x PBS as possible and add RIPA buffer with a protease inhibitor cocktail (10 spheroids = 30 µL of RIPA buffer).
5. Lyse the cells by pipetting up and down and perform sonication for 30 s with 30 s of resting on ice for 10 cycles.
6. Centrifuge the protein lysates at 15000 x g for 15 min at 4 °C.
7. Determine the protein concentration for each cell lysate.
8. Before loading, boil each cell lysate in a sample buffer at 100 °C for 10 min.
9. Load equal amounts of protein into the wells of the SDS-PAGE gel and run the gel for 1 - 2 h at 100 V.
10. Transfer the protein from the gel to the PVDF membrane.
11. After transferring, block the membrane for 1 h at room temperature using a blocking buffer (5% skim milk + TBS with 0.05% Tween-20).
12. Incubate the membrane with 1:1,000 dilutions of primary antibody (Table 4) in 1x TBST with 5% BSA buffer at 4 °C overnight.
13. Wash the membrane three times with TBST, 15 min for each wash.
14. Incubate the membrane with 1:2,500 dilutions of secondary antibody in the blocking buffer at room temperature for 2 h (see Table of Materials).
15. Wash the membrane three times with TBST, 15 min for each wash.
16. Prepare the membrane for HRP detection with a chemiluminescent substrate.
17. Acquire chemiluminescent images.

7. Propidium Iodide (PI) staining of spheroids

1. Prepare 5-10 spheroids as described in Step 4.1 and place the spheroids in an incubator at 37 °C and 5% CO₂.
2. Dilute a 1 mg/mL stock of PI 1:100 in 1x PBS.
3. Remove 50% of the medium from each well of the 96-well plate.
4. Add 100 µL of the PI solution to each well and place the wells in an incubator at 37 °C and 5% CO₂ for 10 - 15 min.
5. Wash out the PI solution with 1x PBS.
6. Add 200 µL of growth medium and take an image using a fluorescence microscope. Analyze the fluorescence intensity using Image J to get the viability count of the spheroid.

8. FACS analysis of spheroids

1. Generate spheroids as described previously.
2. For each condition, prepare 30 - 40 spheroids in a FACS tube and centrifuge for 3 min at 400 x g and RT.
3. Aspirate the supernatant and wash the spheroids in 3 mL of 1x PBS, then centrifuge at 400 x g for 3 min at 4 °C.
4. Aspirate the supernatant and add 200 µL of 0.25% Trypsin-EDTA, then incubate at RT for 2 -3 min.
   NOTE: The incubation time is dependent on the spheroid size and cell type.
5. Add 1 mL of FACS buffer and gently dissociate the spheroids using a 200 μL pipette.
6. Centrifuge the dissociated cells at 400 x g and 4 °C for 3 min.
   NOTE: FACS buffer = 1x PBS + 2.5% FBS, filtered using a 0.22 µm top filter.
7. Discard the supernatant and add 7-AAD/Annexin V reagent (7AAD (5 µL), Annexin V (5 µL)/sample).
8. Gently vortex the cells and incubate for 13 - 30 min at RT in the dark.
9. Add 500 µL of FACS buffer and filter the cells using conical polystyrene test tubes to remove aggregate cells.
10. Centrifuge at 400 x g and 4 °C for 3 min.
11. Add 500 µL of Annexin V binding buffer to each tube and resuspend.
12. Analyze using a flow cytometer.

Representative Results

We describe the protocol of obtaining spheroids from diverse colorectal cancer cell lines. Supplementation with methylcellulose was required to generate spheroids. We also present a method of LCFS preparation and present a model to study the correlation between probiotics and colorectal cancer. Spheroid formation and LCFS preparation protocols are schematically illustrated in Figure 1A,B. As shown in Figure 2A, methylcellulose concentration of 0.6% transforms the cancer cells into compact spheroids. This result indicates that spheroids can be generated from several types of colorectal cancer by using our methylcellulose protocol. Next, the spheroids were treated with 25% LCFS and the morphology was studied after 48 h using a light microscope. As shown in Figure 3A, the spheroids of the groups treated with LCFS exhibited disrupted surfaces. To investigate the anti-cancer effects of LCFS at suitable concentrations, the spheroids were treated for 48 h with various dosages of LCFS: 0 (control), 6%, 12.5%, and 25%. Disruptions in the spheroid morphology were observed in spheroids treated with 25% LCFS, as shown in Figure 3B. In addition, the spheroids were treated with 25% LCFS for 24 h and 48 h, and disruptions in spheroid morphology were observed after 48 h of treatment. Microscopic images of the spheroids are shown in Figure 3C.

After 48 h, the samples were assessed with cell viability assay, and colorectal cancer cell death was observed upon treatment with LCFS in a dose dependent manner, higher the LCFS amount higher the observed cell death (Figure 3D). We, then, stained the samples with propidium iodide (PI) to observe apoptosis. As expected, the induction of apoptosis was dependent on the LCFS dose (Figure 4A,B,C). RT-PCR was performed to detect the changes in molecular markers of apoptosis i.e., BAX, BAK and NOXA (Figure 5A,B). Lastly, apoptosis markers were studied using western blotting and Annexin V/7AAD through FACS (Figure 6A,B,C,D). These observations show that LCFS effectively induced apoptosis in the 3D model.

Figure 1: Schematic representation of spheroid formation and LCFS preparation.
(A) Schematic representation images of the LCFS generation protocol are marked by (i-iv) (B) Schematics of the methylcellulose-mediated spheroid formation are marked by (i-iii). Please click here to view a larger version of this figure.

Figure 2: Methylcellulose-mediated spheroid formation.
(A) Representative images of methylcellulose-mediated spheroid formation of HT-29, DLD1, and WiDr. Cells were seeded in ultra-low attachment 96-well round bottom plates with methylcellulose concentrations of 0.1-1.2% for 48 h. Scale bar 10 μm (n=3 for each experiment). Please click here to view a larger version of this figure.

Figure 3: Evaluation of LCFS concentration and spheroid morphology.
(A) Representative images of HT-29 treated with LCFS for 48 h. Scale bar 100 μm. (B) HT-29, DLD1, and WiDr spheroids treated with increasing doses of LCFS for 48 h. All spheroids had disrupted edges at 12.5-25% LCFS. Scale bar 20 μm (n=3 for each experiment) (C) Spheroid morphologies of HT-29, DLD1, and WiDr spheroids treated with 25% LCFS for 24 and 48 h. Scale bar 20 μm (n = 3) (D) Measured cell viability, shown as mean ± SEM. ***, P < 0.05 (n = 3 for each experiment). Please click here to view a larger version of this figure.

Figure 4: Propidium iodide staining of the spheroids.
Representative images of PI staining in (A) HT-29, (B) DLD1, and (C) WiDr spheroids after 48 h of LCFS treatment. The images were acquired using a fluorescence microscope and the increase in PI intensity was measured using Image J. Scale bar 10 μm. The mean ± SEM is shown. ***, P < 0.05 (n = 3 for each experiment). Please click here to view a larger version of this figure.

Figure 5: Apoptosis markers were identified using qRT-PCR.
Apoptosis markers, such as BAX, BAK and NOXA, were quantified. mRNA quantification is presented as a relative expression normalized to (A) β-actin and (B) 18s rRNA. The mean ± SEM is shown. ***, P < 0.05 (n=3 for each experiment). Please click here to view a larger version of this figure.

Figure 6: Apoptosis markers were determined via Western blotting and FACS analysis of the spheroids.
Shown in the figure are western blots of (A) HT-29, (B) DLD1, and (C) WiDr cells after LCFS treatment. PARP1, BCL-XL, and p-IκBα was detected. β-actin was used as an internal control. (D) FACS analysis of apoptosis in HT-29, DLD1, and WiDr spheroids incubated with LCFS. Apoptotic cells were detected by the increase in the fluorescence intensity of Annexin V-FITC. Please click here to view a larger version of this figure.

Reaction	Volume per single 20 μL
2X qPCR mix	10 μL
Forward primer (10 pmols/µL)	1 μL
Reverse primer (10 pmols/µL)	1 μL
cDNA (50 ng/µL)	1 μL
PCR grade water	7 μL

Table 1: PCR reaction mixture.

Primer	Sequence
BAX-Forward	CCCGAGAGGTCTTTTTCCGAG
BAX-Reverse	CCAGCCCATGATGGTTCTGAT
BAK-Forward	ATGGTCACCTTACCTCTGCAA
BAK-Reverse	TCATAGCGTCGGTTGATGTCG
NOXA-Forward	ACCAAGCCGGATTTGCGATT
NOXA-Reverse	ACTTGCACTTGTTCCTCGTGG
18s rRNA-Forward	GATGGGCGGCGGAAAATAG
18s rRNA-Reverse	GCGTGGATTCTGCATAATGGT
β-Actin-Forward	TCCTGTGGCATCCACGAAACT
β-Actin-Reverse	GAAGCATTTGCGGTGGACGAT

Table 2: Primer sequences used in qRT-PCR analysis.

Stage	Temp (ºC)	Time
Initial denaturation	95	10 min
40 cycles:
Step 1	95	15 sec
Step 2	60	60 sec
Melting curve stage	95	15 sec
	60	60 sec
	95	15 sec

Table 3: qRT-PCR conditions.

Antibody	Dilution
PARP 1 (C2-10)	1:1000
BCL-XL (H-5)	1:1000
p-IκBα (B-9)	1:1000
β-actin (C4)	1:1000
Goat Anti-Mouse IgG (H+L)	1:2500
Goat Anti-Rabbit IgG (H+L)	1:2500

Table 4: Antibodies used in western blot analysis.

Discussion

The tissue microenvironment, including neighboring cells and the extracellular matrix (ECM), is fundamental to tissue generation and crucial in the control of cell growth and tissue development¹³. However, 2D cultures have several disadvantages, such as the disruption of cellular interactions, as well as alterations in cell morphology, extracellular environments, and the approach of division¹⁴. 3D cell culture systems have been rigorously studied to better reproduce in vivo effects, and have been proven as more precise systems for in vitro cancer testing^15,16. There is a need for model systems to more accurately predict personalized responses to chemotherapeutics¹⁷.

3D scaffolding was developed for tissue engineering. It acts as a surrogate loss of ECM, representing the available space of tumor cells. In addition, the scaffolding provides physical interactions for cell adhesion and proliferation and causes cells to form appropriate spatial distributions and cell-ECM or cell-cell interactions¹⁸. The methylcellulose (MC) polymer has been continuously studied to determine its suitability in generating MC-based hydrogel systems for applications in 3D cell culture engineering^19,20. However, the intact incorporation of these hydrogels into biomaterials like 3D cell networks remains technically challenging²¹. Therefore, the spheroid formation protocol presented here recommends the titration of MC concentrations and optimization with various time points for each CRC cell line. Cell line-specific characteristics, such as cell aggregation, viability, and death, can significantly affect each of the conditions we tested. This method can provide a means of generating uniform spheroids for testing LCFS on cancer cells.

Probiotics, which are beneficial bacteria, produce active metabolites that can potentially mimic anti-cancer effects. Thus, our study was designed to isolate lactic acid bacteria (LAB) and test the anti-cancer effects of their metabolic extracts from cell-free supernatants (CFS). Our studies provided a method for observing the effects of L. fermentum cell-free supernatants that induces apoptotic cell death in colorectal cancer cells in a 3D system. The mRNA levels of apoptosis markers involved in apoptotic pathways are dramatically induced after LCFS exposure in 3D conditions. Moreover, decreased levels of PARP1 and BCL-XL were expressed in the LCFS-treated 3D spheroid control compared to the control in Figure 4C,D,E. Inhibition of NF-κB activation was, also, observed in 3D cultures after treatment with LCFS. Taken all together, the advantages of culturing cells in 3D include increasing cell-cell interactions and responses to signaling molecules to better mimic in vivo systems. Western blotting using spheroids can lead to quantitative insights into the state of various signaling molecules.

Cell lines have certain limitations as preclinical models of cancer research. Recently, cancer organoids have been utilized in the modeling of personalized anti-cancer therapy^22,23. The treatment of LCFS with probiotics in organoids is expected to be used as a powerful platform to test anti-cancer effects. Moreover, we only tested one of the Lactobacillus species among the various probiotics in the cancer model. Various probiotics are, also, being tested for the prevention of metabolic syndrome, immunological, and neurological disorders^24,25,26. LCFS from Bifidobacterium, Saccharomyces, Streptococcus, Enterococcus, and Akkermansia species are potential candidates for the testing of health benefits through various types of disease models^27,28,29.

Based on this study, it can be concluded that the understanding of signaling in spheroids and the various responses to LCFS treatment in 3D models may be beneficial for testing anti-cancer effects using the method that we proposed. Additionally, 3D cancer models can provide several advantages that are not possible with traditional 2D monolayers.

Materials

Name	Company	Catalog Number	Comments
10% Mini-PROTEAN TGX Precast Protein Gels, 15-well, 15 µl	Biorad	4561036	Pkg of 10
Applied Biosystems MicroAmp Optical Adhesive Film	Thermo Fisher Scientific	4311971	100 covers
10x transfer buffer	Intron	IBS-BT031A	1 L
10X Tris-Glycine (W/SDS)	Intron	IBS-BT014	1 L
Axygen 2.0 mL MaxyClear Snaplock Microcentrifuge Tube, Polypropylene, Clear, Nonsterile, 500 Tubes/Pack, 10 Packs/Case	Corning	SCT-200-C	500 Tubes/Pack, 10 Packs/Case
BD Difco Bacto Agar	BD	214010	500 g
BD Difco Lactobacilli MRS Broth	BD	DF0881-17-5	500 g
CellTiter-Glo 3D Cell viability assay	Promega	G9681	100μl/assay in 96-well plates
Complete Protease Inhibitor Cocktail	Sigma-Aldrich	11697498001	vial of 20 tablets
Corning Phosphate-Buffered Saline, 1X without calcium and magnesium, PH 7.4 ± 0.1	Corning	21-040-CV	500 mL
EMD Millipore Immobilon-P PVDF Transfer Membranes	fisher Scientific	IPVH00010	26.5cm x 3.75m roll; Pore Size: 0.45um
Falcon 5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap	Corning	352235	25/Pack, 500/Case
Fetal Bovine Serum, certified, US origin	Thermo Fisher Scientific	16000044	500 mL
iScript cDNA Synthesis Kit, 25 x 20 µl rxns #1708890	Biorad	1708890	25 x 20 µL rxns
iTaq Universal SYBR Green Supermix	Biorad	1725121	5 x 1 mL
Lactobacillus fermentum	Korean Collection for Type Cultures	KCTC 3112
L-Cysteine hydrochloride monohydrate	Sigma-Aldrich	C6852-25G	25 g
Methyl Cellulose (3500-5600mPa·s, 2% in Water at 20°C)	TCI	M0185	500 g
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL	Applied Biosystems	4346906	20 plates
Millex-GS Syringe Filter Unit, 0.22 µm, mixed cellulose esters, 33 mm, ethylene oxide sterilized	Millipore	SLGS033SB	250
PE Annexin V Apoptosis Detection Kit with 7-AAD	Biolegend	640934	100 tests
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific	15140122	100 mL
Propidium Iodide	Introgen	P1304MP	100 mg
RIPA Lysis and Extraction Buffer	Thermo Fisher Scientific	89901	250 mL
RNeasy Mini Kit (250)	Qiagen	74106	250
RPMI-1640	Gibco	11875-119	500 mL
Trypsin-EDTA (0.25%), phenol red	Thermo Fisher Scientific	25200056	100 mL
Name of Materials/Equipment/Software	Company	Catalog Number	Comments/Description
anti - p-IκBα (B-9)	Santa cruze	sc-8404	200 µg/mL
anti-BclxL (H-5)	Santa cruze	sc-8392	200 µg/mL
anti-PARP 1 (C2-10)	Santa cruze	sc-53643	50 µl ascites
anti-β-actin (C4)	Santa cruze	sc-47778	200 µg/mL
BD FACSVerse	BD Biosciences		San Diego, CA, USA
Synergy HTX Multi-Mode Microplate Reader	BioT	S1LFA
CO2 incubator	Thermo fisher	HERAcell 150i
Conical tube 15 ml	SPL	50015
Conical tube 50 ml	SPL	50050
Corning Costar Ultra-Low Attachment Multiple Well Plate	Sigma-Aldrich	CLS7007
Corning Costar Ultra-Low Attachment Multiple Well Plate	Sigma-Aldrich	CLS3471
Costar 50 mL Reagent Reservoirs, 5/Bag, Sterile	Costar	4870
Countess Cell Counting Chamber Slides	Thermofisher	C10228
Countess II FL Automated Cell Counter	invitrogen	AMQAF1000
EnSpire Multimode Reader	Perkin Elmer		Enspire 2300
Eppendorf Research Plus Multi Channel Pipette, 8-channel	Eppendorf	3122000051
FlowJo software	TreeStar		Ashland, OR, USA
Goat Anti-Mouse IgG (H+L)	Jackson immunoresearch	115-035-062	1.5 mL
Goat Anti-Rabbit IgG (H+L)	Jackson immunoresearch	111-035-144	2.0 mL
GraphPad Prism 5	GraphPad Software		Inc., San Diego, CA, USA
ImageJ	NIH
ImageQuant LAS 4000 mini	Fujifilm		Tokyo, Japan
Incubated shaker	Lab companion	SIF-6000R
Multi Gauge Ver. 3.0,	Fujifilm		Tokyo, Japan
Optical density (OD)LAMBDA UV/Vis Spectrophotometers	Perkin Elmer		Waltham, MA, USA
Phase-contrast microscope	Olympus		Tokyo, Japan
SPL microcentrifuge tube 1.5mL	SPL	60015
SPL Multi Channel Reservoirs, 12-Chs, PS, Sterile	SPL	21012
StepOnePlus Real-Time PCR system	Thermo Fisher Scientific		Waltham, MA, USA
Vibra-Cell Ultrasonic Liquid Processors	SONICS-vibra cell	VC 505	500 Watt ultrasonic processor
Vinyl Anaerobic Chamber	COY LAB PRODUCTS